HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Alloprevotella tannerae (GCA_937906735.1)

Select a Genome:
BAKTA Annotations for GCA_937906735.1
Genome Selected: Alloprevotella tannerae
ContigsBases CDSrRNA tmRNAtRNA
71 2,301,845 1843 3 1 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3786 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 3786 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 CALCXS010000055.1 GCA937906735_01504 CDS open 4043-4891 _na     282_aa Phosphatidate cytidylyltransferase
3002 CALCXS010000055.1 GCA937906735_01505 CDS open 5455-6771 _na     438_aa pspC PspC domain protein
3003 CALCXS010000055.1 GCA937906735_01506 CDS open 6768-7154 _na     128_aa padR Transcriptional regulator%2C PadR family
3004 CALCXS010000055.1 GCA937906735_01507 CDS open 7345-7563 _na     72_aa hypothetical protein
3005 CALCXS010000055.1 GCA937906735_01508 CDS open 7625-8596 _na     323_aa Putative mannose-6-phosphate isomerase%2C class I
3006 CALCXS010000055.1 GCA937906735_01509 CDS open 8699-9178 _na     159_aa hypothetical protein
3007 CALCXS010000055.1 GCA937906735_01510 CDS open 9246-11543 _na     765_aa trkA TrkA C-terminal domain protein
3008 CALCXS010000055.1 GCA937906735_01511 CDS open 11610-12839 _na     409_aa pepT peptidase T
3009 CALCXS010000055.1 GCA937906735_01513 CDS open 13866-14345 _na     159_aa Arginine repressor
3010 CALCXS010000055.1 GCA937906735_01514 CDS open 14673-15293 _na     206_aa tetR Transcriptional regulator%2C TetR family
3011 CALCXS010000055.1 GCA937906735_01515 CDS open 15684-17978 _na     764_aa Phosphate acetyl/butyryl transferase
3012 CALCXS010000055.1 GCA937906735_01516 CDS open 18781-20244 _na     487_aa mepA Multidrug export protein MepA
3013 CALCXS010000055.1 GCA937906735_01517 CDS open 20267-20914 _na     215_aa Cytidylate kinase
3014 CALCXS010000055.1 GCA937906735_01518 CDS open 20911-21447 _na     178_aa Phosphoesterase
3015 CALCXS010000055.1 GCA937906735_01519 CDS open 21409-22311 _na     300_aa menA 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase
3016 CALCXS010000055.1 GCA937906735_01520 CDS open 22416-23330 _na     304_aa Nucleotidyl transferase domain-containing protein
3017 CALCXS010000055.1 GCA937906735_01521 CDS open 24732-24830 _na     32_aa hypothetical protein
3018 CALCXS010000055.1 GCA937906735_01522 CDS open 24825-26888 _na     687_aa TonB-dependent receptor
3019 CALCXS010000055.1 GCA937906735_01523 CDS open 27111-27710 _na     199_aa Outer membrane protein beta-barrel domain-containing protein
3020 CALCXS010000055.1 GCA937906735_01524 CDS open 28217-29317 _na     366_aa GDP-L-fucose synthase
3021 CALCXS010000055.1 GCA937906735_01525 CDS open 29357-29728 _na     123_aa DUF488 domain-containing protein
3022 CALCXS010000055.1 GCA937906735_01526 CDS open 29792-29983 _na     63_aa rpsU 30S ribosomal protein S21
3023 CALCXS010000055.1 GCA937906735_01527 CDS open 30593-32584 _na     663_aa rho transcription termination factor Rho
3024 CALCXS010000055.1 GCA937906735_01528 CDS open 32860-34746 _na     628_aa abc-f ribosomal protection-like ABC-F family protein
3025 CALCXS010000055.1 GCA937906735_01529 CDS open 34763-36031 _na     422_aa ATPase%2C AAA family
3026 CALCXS010000055.1 GCA937906735_01530 CDS open 36172-38328 _na     718_aa tetQ Tetracycline resistance protein TetQ
3027 CALCXS010000055.1 GCA937906735_01531 CDS open 39219-41276 _na     685_aa htpG molecular chaperone HtpG
3028 CALCXS010000055.1 GCA937906735_01532 CDS open 41568-43325 _na     585_aa putative transporter
3029 CALCXS010000055.1 GCA937906735_01533 CDS open 43595-44698 _na     367_aa gmd GDP-mannose 4%2C6-dehydratase
3030 CALCXS010000055.1 GCA937906735_01534 CDS open 44809-45873 _na     354_aa Phytase-like domain-containing protein
3031 CALCXS010000055.1 GCA937906735_01500 gene open 562-1248
3032 CALCXS010000055.1 GCA937906735_01502 gene open 1551-1910 rsfS
3033 CALCXS010000055.1 GCA937906735_01503 gene open 1912-4050 ftsH
3034 CALCXS010000055.1 GCA937906735_01504 gene open 4043-4891
3035 CALCXS010000055.1 GCA937906735_01505 gene open 5455-6771 pspC
3036 CALCXS010000055.1 GCA937906735_01506 gene open 6768-7154 padR
3037 CALCXS010000055.1 GCA937906735_01507 gene open 7345-7563
3038 CALCXS010000055.1 GCA937906735_01508 gene open 7625-8596
3039 CALCXS010000055.1 GCA937906735_01509 gene open 8699-9178
3040 CALCXS010000055.1 GCA937906735_01510 gene open 9246-11543 trkA
3041 CALCXS010000055.1 GCA937906735_01511 gene open 11610-12839 pepT
3042 CALCXS010000055.1 GCA937906735_01513 gene open 13866-14345
3043 CALCXS010000055.1 GCA937906735_01514 gene open 14673-15293 tetR
3044 CALCXS010000055.1 GCA937906735_01515 gene open 15684-17978
3045 CALCXS010000055.1 GCA937906735_01516 gene open 18781-20244 mepA
3046 CALCXS010000055.1 GCA937906735_01517 gene open 20267-20914
3047 CALCXS010000055.1 GCA937906735_01518 gene open 20911-21447
3048 CALCXS010000055.1 GCA937906735_01519 gene open 21409-22311 menA
3049 CALCXS010000055.1 GCA937906735_01520 gene open 22416-23330
3050 CALCXS010000055.1 GCA937906735_01521 gene open 24732-24830
3051 CALCXS010000055.1 GCA937906735_01522 gene open 24825-26888
3052 CALCXS010000055.1 GCA937906735_01523 gene open 27111-27710
3053 CALCXS010000055.1 GCA937906735_01524 gene open 28217-29317
3054 CALCXS010000055.1 GCA937906735_01525 gene open 29357-29728
3055 CALCXS010000055.1 GCA937906735_01526 gene open 29792-29983 rpsU
3056 CALCXS010000055.1 GCA937906735_01527 gene open 30593-32584 rho
3057 CALCXS010000055.1 GCA937906735_01528 gene open 32860-34746 abc-f
3058 CALCXS010000055.1 GCA937906735_01529 gene open 34763-36031
3059 CALCXS010000055.1 GCA937906735_01530 gene open 36172-38328 tetQ
3060 CALCXS010000055.1 GCA937906735_01531 gene open 39219-41276 htpG
3061 CALCXS010000055.1 GCA937906735_01532 gene open 41568-43325
3062 CALCXS010000055.1 GCA937906735_01533 gene open 43595-44698 gmd
3063 CALCXS010000055.1 GCA937906735_01534 gene open 44809-45873
3064 CALCXS010000055.1 GCA937906735_01501 gene open 1295-1365 trnQ
3065 CALCXS010000055.1 GCA937906735_01512 gene open 13020-13092 trnF
3066 CALCXS010000055.1 GCA937906735_01501 tRNA open 1295-1365 trnQ tRNA-Gln(ctg)
3067 CALCXS010000055.1 GCA937906735_01512 tRNA open 13020-13092 trnF tRNA-Phe(gaa)
3068 CALCXS010000056.1 GCA937906735_01535 CDS open 526-2547 _na     673_aa Transketolase%2C thiamine diphosphate binding domain protein
3069 CALCXS010000056.1 GCA937906735_01536 CDS open 2656-3891 _na     411_aa Transglycosylase SLT domain protein
3070 CALCXS010000056.1 GCA937906735_01537 CDS open 4581-5375 _na     264_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
3071 CALCXS010000056.1 GCA937906735_01538 CDS open 5382-6764 _na     460_aa nodT Efflux transporter%2C outer membrane factor lipoprotein%2C NodT family
3072 CALCXS010000056.1 GCA937906735_01539 CDS open 6769-9975 _na     1068_aa RND transporter%2C HAE1 family
3073 CALCXS010000056.1 GCA937906735_01540 CDS open 10008-11114 _na     368_aa Efflux transporter%2C RND family%2C MFP subunit
3074 CALCXS010000056.1 GCA937906735_01541 CDS open 11367-12218 _na     283_aa Glycosyl hydrolase family 25
3075 CALCXS010000056.1 GCA937906735_01542 CDS open 12291-13943 _na     550_aa diphosphate--fructose-6-phosphate 1-phosphotransferase
3076 CALCXS010000056.1 GCA937906735_01543 CDS open 15025-15531 _na     168_aa DUF4476 domain-containing protein
3077 CALCXS010000056.1 GCA937906735_01544 CDS open 15528-16157 _na     209_aa ruvC crossover junction endodeoxyribonuclease RuvC
3078 CALCXS010000056.1 GCA937906735_01545 CDS open 16319-16705 _na     128_aa DUF1573 domain-containing protein
3079 CALCXS010000056.1 GCA937906735_01546 CDS open 16711-17766 _na     351_aa Putative mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase
3080 CALCXS010000056.1 GCA937906735_01547 CDS open 17759-18829 _na     356_aa mutY A/G-specific adenine glycosylase
3081 CALCXS010000056.1 GCA937906735_01548 CDS open 18941-20362 _na     473_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
3082 CALCXS010000056.1 GCA937906735_01549 CDS open 20382-21062 _na     226_aa HEAT repeat domain-containing protein
3083 CALCXS010000056.1 GCA937906735_01550 CDS open 21073-23430 _na     785_aa Zinc-dependent metalloprotease
3084 CALCXS010000056.1 GCA937906735_01551 CDS open 23859-26183 _na     774_aa TonB-dependent receptor
3085 CALCXS010000056.1 GCA937906735_01552 CDS open 26465-28477 _na     670_aa Helix-hairpin-helix domain-containing protein
3086 CALCXS010000056.1 GCA937906735_01553 CDS open 28548-29702 _na     384_aa obgE GTPase ObgE
3087 CALCXS010000056.1 GCA937906735_01554 CDS open 29771-30340 _na     189_aa adenylate kinase
3088 CALCXS010000056.1 GCA937906735_01555 CDS open 30352-30888 _na     178_aa hpt hypoxanthine phosphoribosyltransferase
3089 CALCXS010000056.1 GCA937906735_01556 CDS open 31441-32640 _na     399_aa hypothetical protein
3090 CALCXS010000056.1 GCA937906735_01557 CDS open 32646-33110 _na     154_aa MaoC-like protein
3091 CALCXS010000056.1 GCA937906735_01558 CDS open 33132-33731 _na     199_aa yigZ Putative YigZ family protein
3092 CALCXS010000056.1 GCA937906735_01559 CDS open 33728-34270 _na     180_aa N-acetyltransferase domain-containing protein
3093 CALCXS010000056.1 GCA937906735_01560 CDS open 34246-34593 _na     115_aa 6-carboxy-5%2C6%2C7%2C8-tetrahydropterin synthase
3094 CALCXS010000056.1 GCA937906735_01561 CDS open 34580-35149 _na     189_aa 7-carboxy-7-deazaguanine synthase
3095 CALCXS010000056.1 GCA937906735_01562 CDS open 35264-35608 _na     114_aa rpsF 30S ribosomal protein S6
3096 CALCXS010000056.1 GCA937906735_01563 CDS open 35611-35877 _na     88_aa rpsR 30S ribosomal protein S18
3097 CALCXS010000056.1 GCA937906735_01564 CDS open 35894-36439 _na     181_aa rplI 50S ribosomal protein L9
3098 CALCXS010000056.1 GCA937906735_01565 CDS open 36532-37302 _na     256_aa truA tRNA pseudouridine(38-40) synthase TruA
3099 CALCXS010000056.1 GCA937906735_01566 CDS open 37311-38762 _na     483_aa Right handed beta helix domain-containing protein
3100 CALCXS010000056.1 GCA937906735_01567 CDS open 39054-39800 _na     248_aa ABC transporter permease
3101 CALCXS010000056.1 GCA937906735_01568 CDS open 39797-40588 _na     263_aa ABC transporter%2C ATP-binding protein
3102 CALCXS010000056.1 GCA937906735_01569 CDS open 41171-43207 _na     678_aa 1%2C4-alpha-glucan branching enzyme
3103 CALCXS010000056.1 GCA937906735_01570 CDS open 43295-44407 _na     370_aa hypothetical protein
3104 CALCXS010000056.1 GCA937906735_01571 CDS open 44404-45162 _na     252_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
3105 CALCXS010000056.1 GCA937906735_01572 CDS open 45237-47738 _na     833_aa peptidoglycan glycosyltransferase
3106 CALCXS010000056.1 GCA937906735_01535 gene open 526-2547
3107 CALCXS010000056.1 GCA937906735_01536 gene open 2656-3891
3108 CALCXS010000056.1 GCA937906735_01537 gene open 4581-5375 lpxA
3109 CALCXS010000056.1 GCA937906735_01538 gene open 5382-6764 nodT
3110 CALCXS010000056.1 GCA937906735_01539 gene open 6769-9975
3111 CALCXS010000056.1 GCA937906735_01540 gene open 10008-11114
3112 CALCXS010000056.1 GCA937906735_01541 gene open 11367-12218
3113 CALCXS010000056.1 GCA937906735_01542 gene open 12291-13943
3114 CALCXS010000056.1 GCA937906735_01543 gene open 15025-15531
3115 CALCXS010000056.1 GCA937906735_01544 gene open 15528-16157 ruvC
3116 CALCXS010000056.1 GCA937906735_01545 gene open 16319-16705
3117 CALCXS010000056.1 GCA937906735_01546 gene open 16711-17766
3118 CALCXS010000056.1 GCA937906735_01547 gene open 17759-18829 mutY
3119 CALCXS010000056.1 GCA937906735_01548 gene open 18941-20362 rlmD
3120 CALCXS010000056.1 GCA937906735_01549 gene open 20382-21062
3121 CALCXS010000056.1 GCA937906735_01550 gene open 21073-23430
3122 CALCXS010000056.1 GCA937906735_01551 gene open 23859-26183
3123 CALCXS010000056.1 GCA937906735_01552 gene open 26465-28477
3124 CALCXS010000056.1 GCA937906735_01553 gene open 28548-29702 obgE
3125 CALCXS010000056.1 GCA937906735_01554 gene open 29771-30340
3126 CALCXS010000056.1 GCA937906735_01555 gene open 30352-30888 hpt
3127 CALCXS010000056.1 GCA937906735_01556 gene open 31441-32640
3128 CALCXS010000056.1 GCA937906735_01557 gene open 32646-33110
3129 CALCXS010000056.1 GCA937906735_01558 gene open 33132-33731 yigZ
3130 CALCXS010000056.1 GCA937906735_01559 gene open 33728-34270
3131 CALCXS010000056.1 GCA937906735_01560 gene open 34246-34593
3132 CALCXS010000056.1 GCA937906735_01561 gene open 34580-35149
3133 CALCXS010000056.1 GCA937906735_01562 gene open 35264-35608 rpsF
3134 CALCXS010000056.1 GCA937906735_01563 gene open 35611-35877 rpsR
3135 CALCXS010000056.1 GCA937906735_01564 gene open 35894-36439 rplI
3136 CALCXS010000056.1 GCA937906735_01565 gene open 36532-37302 truA
3137 CALCXS010000056.1 GCA937906735_01566 gene open 37311-38762
3138 CALCXS010000056.1 GCA937906735_01567 gene open 39054-39800
3139 CALCXS010000056.1 GCA937906735_01568 gene open 39797-40588
3140 CALCXS010000056.1 GCA937906735_01569 gene open 41171-43207
3141 CALCXS010000056.1 GCA937906735_01570 gene open 43295-44407
3142 CALCXS010000056.1 GCA937906735_01571 gene open 44404-45162 kdsB
3143 CALCXS010000056.1 GCA937906735_01572 gene open 45237-47738
3144 CALCXS010000056.1 GCA937906735_01573 gene open 47983-48056 trnR
3145 CALCXS010000056.1 GCA937906735_01573 tRNA open 47983-48056 trnR tRNA-Arg(tct)
3146 CALCXS010000057.1 GCA937906735_01574 CDS open 240-686 _na     148_aa hypothetical protein
3147 CALCXS010000057.1 GCA937906735_01575 CDS open 683-991 _na     102_aa hypothetical protein
3148 CALCXS010000057.1 GCA937906735_01576 CDS open 1311-1721 _na     136_aa Viral histone-like protein
3149 CALCXS010000057.1 GCA937906735_01577 CDS open 2406-3176 _na     256_aa Acyl-[acyl-carrier-protein] thioesterase
3150 CALCXS010000057.1 GCA937906735_01578 CDS open 3315-4016 _na     233_aa Antioxidant%2C AhpC/TSA family
3151 CALCXS010000057.1 GCA937906735_01579 CDS open 4031-6307 _na     758_aa Peptidase%2C S9A/B/C family%2C catalytic domain protein
3152 CALCXS010000057.1 GCA937906735_01580 CDS open 6893-7096 _na     67_aa Entericidin
3153 CALCXS010000057.1 GCA937906735_01581 CDS open 7579-8964 _na     461_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
3154 CALCXS010000057.1 GCA937906735_01582 CDS open 9025-10077 _na     350_aa Glycosyltransferase%2C group 2 family protein
3155 CALCXS010000057.1 GCA937906735_01583 CDS open 10037-10840 _na     267_aa Tetrapyrrole methylase family protein
3156 CALCXS010000057.1 GCA937906735_01574 gene open 240-686
3157 CALCXS010000057.1 GCA937906735_01575 gene open 683-991
3158 CALCXS010000057.1 GCA937906735_01576 gene open 1311-1721
3159 CALCXS010000057.1 GCA937906735_01577 gene open 2406-3176
3160 CALCXS010000057.1 GCA937906735_01578 gene open 3315-4016
3161 CALCXS010000057.1 GCA937906735_01579 gene open 4031-6307
3162 CALCXS010000057.1 GCA937906735_01580 gene open 6893-7096
3163 CALCXS010000057.1 GCA937906735_01581 gene open 7579-8964 mtaB
3164 CALCXS010000057.1 GCA937906735_01582 gene open 9025-10077
3165 CALCXS010000057.1 GCA937906735_01583 gene open 10037-10840
3166 CALCXS010000058.1 GCA937906735_01584 CDS open 2272-3165 _na     297_aa Hydrolase%2C carbon-nitrogen family
3167 CALCXS010000058.1 GCA937906735_01585 CDS open 3162-4292 _na     376_aa Agmatine deiminase
3168 CALCXS010000058.1 GCA937906735_01586 CDS open 4314-5918 _na     534_aa 5'-nucleotidase%2C C-terminal domain protein
3169 CALCXS010000058.1 GCA937906735_01587 CDS open 5923-8799 _na     958_aa bifunctional fucokinase/fucose-1-phosphate guanylyltransferase
3170 CALCXS010000058.1 GCA937906735_01588 CDS open 8796-9194 _na     132_aa GtrA-like protein
3171 CALCXS010000058.1 GCA937906735_01589 CDS open 9955-11268 _na     437_aa UDP-glucose 6-dehydrogenase
3172 CALCXS010000058.1 GCA937906735_01590 CDS open 11336-11665 _na     109_aa secG preprotein translocase subunit SecG
3173 CALCXS010000058.1 GCA937906735_01591 CDS open 11667-12419 _na     250_aa Tetratricopeptide repeat protein
3174 CALCXS010000058.1 GCA937906735_01592 CDS open 12427-12942 _na     171_aa Lipopolysaccharide-assembly
3175 CALCXS010000058.1 GCA937906735_01593 CDS open 12926-14122 _na     398_aa Sigma-54 interaction domain protein
3176 CALCXS010000058.1 GCA937906735_01594 CDS open 14457-15041 _na     194_aa hypothetical protein
3177 CALCXS010000058.1 GCA937906735_01584 gene open 2272-3165
3178 CALCXS010000058.1 GCA937906735_01585 gene open 3162-4292
3179 CALCXS010000058.1 GCA937906735_01586 gene open 4314-5918
3180 CALCXS010000058.1 GCA937906735_01587 gene open 5923-8799
3181 CALCXS010000058.1 GCA937906735_01588 gene open 8796-9194
3182 CALCXS010000058.1 GCA937906735_01589 gene open 9955-11268
3183 CALCXS010000058.1 GCA937906735_01590 gene open 11336-11665 secG
3184 CALCXS010000058.1 GCA937906735_01591 gene open 11667-12419
3185 CALCXS010000058.1 GCA937906735_01592 gene open 12427-12942
3186 CALCXS010000058.1 GCA937906735_01593 gene open 12926-14122
3187 CALCXS010000058.1 GCA937906735_01594 gene open 14457-15041
3188 CALCXS010000059.1 GCA937906735_01595 CDS open 1125-1751 _na     208_aa CDP-alcohol phosphatidyltransferase family protein
3189 CALCXS010000059.1 GCA937906735_01596 CDS open 1748-2587 _na     279_aa hypothetical protein
3190 CALCXS010000059.1 GCA937906735_01597 CDS open 2634-2828 _na     64_aa hypothetical protein
3191 CALCXS010000059.1 GCA937906735_01598 CDS open 2907-4361 _na     484_aa apeA ApeA N-terminal domain-containing protein
3192 CALCXS010000059.1 GCA937906735_01599 CDS open 4483-4755 _na     90_aa Helix-turn-helix transcriptional regulator
3193 CALCXS010000059.1 GCA937906735_01600 CDS open 4799-5374 _na     191_aa hypothetical protein
3194 CALCXS010000059.1 GCA937906735_01601 CDS open 5547-5876 _na     109_aa hypothetical protein
3195 CALCXS010000059.1 GCA937906735_01602 CDS open 5907-6542 _na     211_aa Fic family protein
3196 CALCXS010000059.1 GCA937906735_01603 CDS open 6550-6765 _na     71_aa hypothetical protein
3197 CALCXS010000059.1 GCA937906735_01604 CDS open 6768-7298 _na     176_aa t-SNARE coiled-coil-like y domain-containing protein
3198 CALCXS010000059.1 GCA937906735_01605 CDS open 7527-8672 _na     381_aa Transposase IS110-like N-terminal domain-containing protein
3199 CALCXS010000059.1 GCA937906735_01606 CDS open 8796-9011 _na     71_aa Helix-turn-helix transcriptional regulator
3200 CALCXS010000059.1 GCA937906735_01607 CDS open 9140-9796 _na     218_aa DUF6037 domain-containing protein
3201 CALCXS010000059.1 GCA937906735_01608 CDS open 9904-10395 _na     163_aa hypothetical protein
3202 CALCXS010000059.1 GCA937906735_01609 CDS open 10383-11390 _na     335_aa ImmA/IrrE family metallo-endopeptidase
3203 CALCXS010000059.1 GCA937906735_01610 CDS open 11387-12169 _na     260_aa XRE family transcriptional regulator
3204 CALCXS010000059.1 GCA937906735_01611 CDS open 12920-14287 _na     455_aa hypothetical protein
3205 CALCXS010000059.1 GCA937906735_01595 gene open 1125-1751
3206 CALCXS010000059.1 GCA937906735_01596 gene open 1748-2587
3207 CALCXS010000059.1 GCA937906735_01597 gene open 2634-2828
3208 CALCXS010000059.1 GCA937906735_01598 gene open 2907-4361 apeA
3209 CALCXS010000059.1 GCA937906735_01599 gene open 4483-4755
3210 CALCXS010000059.1 GCA937906735_01600 gene open 4799-5374
3211 CALCXS010000059.1 GCA937906735_01601 gene open 5547-5876
3212 CALCXS010000059.1 GCA937906735_01602 gene open 5907-6542
3213 CALCXS010000059.1 GCA937906735_01603 gene open 6550-6765
3214 CALCXS010000059.1 GCA937906735_01604 gene open 6768-7298
3215 CALCXS010000059.1 GCA937906735_01605 gene open 7527-8672
3216 CALCXS010000059.1 GCA937906735_01606 gene open 8796-9011
3217 CALCXS010000059.1 GCA937906735_01607 gene open 9140-9796
3218 CALCXS010000059.1 GCA937906735_01608 gene open 9904-10395
3219 CALCXS010000059.1 GCA937906735_01609 gene open 10383-11390
3220 CALCXS010000059.1 GCA937906735_01610 gene open 11387-12169
3221 CALCXS010000059.1 GCA937906735_01611 gene open 12920-14287
3222 CALCXS010000060.1 GCA937906735_01612 CDS open 890-1345 _na     151_aa Transposase DDE domain-containing protein
3223 CALCXS010000060.1 GCA937906735_01612 gene open 890-1345
3224 CALCXS010000061.1 GCA937906735_01613 CDS open 320-1567 _na     415_aa Outer membrane insertion signal domain protein
3225 CALCXS010000061.1 GCA937906735_01614 CDS open 1620-2045 _na     141_aa Fe-S metabolism associated domain protein
3226 CALCXS010000061.1 GCA937906735_01615 CDS open 2105-3094 _na     329_aa Peptidase%2C M28 family
3227 CALCXS010000061.1 GCA937906735_01616 CDS open 3157-4920 _na     587_aa Membrane dipeptidase
3228 CALCXS010000061.1 GCA937906735_01617 CDS open 4910-5095 _na     61_aa hypothetical protein
3229 CALCXS010000061.1 GCA937906735_01618 CDS open 5132-5428 _na     98_aa DUF4491 domain-containing protein
3230 CALCXS010000061.1 GCA937906735_01619 CDS open 5428-5949 _na     173_aa asnC Transcriptional regulator%2C AsnC family
3231 CALCXS010000061.1 GCA937906735_01620 CDS open 7209-7871 _na     220_aa Bacterial sugar transferase
3232 CALCXS010000061.1 GCA937906735_01621 CDS open 8233-8409 _na     58_aa hypothetical protein
3233 CALCXS010000061.1 GCA937906735_01622 CDS open 8995-10233 _na     412_aa Transporter gate domain protein
3234 CALCXS010000061.1 GCA937906735_01623 CDS open 10335-11840 _na     501_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
3235 CALCXS010000061.1 GCA937906735_01624 CDS open 11948-12415 _na     155_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
3236 CALCXS010000061.1 GCA937906735_01625 CDS open 12570-14678 _na     702_aa nrdD anaerobic ribonucleoside-triphosphate reductase
3237 CALCXS010000061.1 GCA937906735_01626 CDS open 14703-14918 _na     71_aa hypothetical protein
3238 CALCXS010000061.1 GCA937906735_01627 CDS open 15933-16151 _na     72_aa hypothetical protein
3239 CALCXS010000061.1 GCA937906735_01613 gene open 320-1567
3240 CALCXS010000061.1 GCA937906735_01614 gene open 1620-2045
3241 CALCXS010000061.1 GCA937906735_01615 gene open 2105-3094
3242 CALCXS010000061.1 GCA937906735_01616 gene open 3157-4920
3243 CALCXS010000061.1 GCA937906735_01617 gene open 4910-5095
3244 CALCXS010000061.1 GCA937906735_01618 gene open 5132-5428
3245 CALCXS010000061.1 GCA937906735_01619 gene open 5428-5949 asnC
3246 CALCXS010000061.1 GCA937906735_01620 gene open 7209-7871
3247 CALCXS010000061.1 GCA937906735_01621 gene open 8233-8409
3248 CALCXS010000061.1 GCA937906735_01622 gene open 8995-10233
3249 CALCXS010000061.1 GCA937906735_01623 gene open 10335-11840
3250 CALCXS010000061.1 GCA937906735_01624 gene open 11948-12415 nrdG
3251 CALCXS010000061.1 GCA937906735_01625 gene open 12570-14678 nrdD
3252 CALCXS010000061.1 GCA937906735_01626 gene open 14703-14918
3253 CALCXS010000061.1 GCA937906735_01627 gene open 15933-16151
3254 CALCXS010000062.1 GCA937906735_01628 CDS open 190-843 _na     217_aa hypothetical protein
3255 CALCXS010000062.1 GCA937906735_01629 CDS open 1185-1598 _na     137_aa t-SNARE coiled-coil-like y domain-containing protein
3256 CALCXS010000062.1 GCA937906735_01630 CDS open 1836-3338 _na     500_aa AAA family ATPase
3257 CALCXS010000062.1 GCA937906735_01631 CDS open 3808-4152 _na     114_aa SLATT domain-containing protein
3258 CALCXS010000062.1 GCA937906735_01632 CDS open 4328-4528 _na     66_aa hypothetical protein
3259 CALCXS010000062.1 GCA937906735_01633 CDS open 4842-5096 _na     84_aa Transposase IS30-like HTH domain-containing protein
3260 CALCXS010000062.1 GCA937906735_01628 gene open 190-843
3261 CALCXS010000062.1 GCA937906735_01629 gene open 1185-1598
3262 CALCXS010000062.1 GCA937906735_01630 gene open 1836-3338
3263 CALCXS010000062.1 GCA937906735_01631 gene open 3808-4152
3264 CALCXS010000062.1 GCA937906735_01632 gene open 4328-4528
3265 CALCXS010000062.1 GCA937906735_01633 gene open 4842-5096
3266 CALCXS010000063.1 GCA937906735_01634 CDS open 1041-2048 _na     335_aa Endolytic murein transglycosylase
3267 CALCXS010000063.1 GCA937906735_01635 CDS open 2172-2621 _na     149_aa Lipocalin-like domain-containing protein
3268 CALCXS010000063.1 GCA937906735_01638 CDS open 3103-3933 _na     276_aa pyrF orotidine-5'-phosphate decarboxylase
3269 CALCXS010000063.1 GCA937906735_01639 CDS open 3996-5111 _na     371_aa prfA peptide chain release factor 1
3270 CALCXS010000063.1 GCA937906735_01640 CDS open 5147-6295 _na     382_aa Phosphoribosylformylglycinamidine cyclo-ligase
3271 CALCXS010000063.1 GCA937906735_01641 CDS open 6345-6947 _na     200_aa lemA LemA family protein
3272 CALCXS010000063.1 GCA937906735_01642 CDS open 7019-7945 _na     308_aa TPM domain-containing protein
3273 CALCXS010000063.1 GCA937906735_01643 CDS open 8566-9480 _na     304_aa ribonuclease Z
3274 CALCXS010000063.1 GCA937906735_01644 CDS open 9595-10635 _na     346_aa galE UDP-glucose 4-epimerase GalE
3275 CALCXS010000063.1 GCA937906735_01645 CDS open 10710-11858 _na     382_aa nspC carboxynorspermidine decarboxylase
3276 CALCXS010000063.1 GCA937906735_01646 CDS open 11899-13404 _na     501_aa Peptide transporter
3277 CALCXS010000063.1 GCA937906735_01634 gene open 1041-2048
3278 CALCXS010000063.1 GCA937906735_01635 gene open 2172-2621
3279 CALCXS010000063.1 GCA937906735_01638 gene open 3103-3933 pyrF
3280 CALCXS010000063.1 GCA937906735_01639 gene open 3996-5111 prfA
3281 CALCXS010000063.1 GCA937906735_01640 gene open 5147-6295
3282 CALCXS010000063.1 GCA937906735_01641 gene open 6345-6947 lemA
3283 CALCXS010000063.1 GCA937906735_01642 gene open 7019-7945
3284 CALCXS010000063.1 GCA937906735_01643 gene open 8566-9480
3285 CALCXS010000063.1 GCA937906735_01644 gene open 9595-10635 galE
3286 CALCXS010000063.1 GCA937906735_01645 gene open 10710-11858 nspC
3287 CALCXS010000063.1 GCA937906735_01646 gene open 11899-13404
3288 CALCXS010000063.1 GCA937906735_01636 gene open 2762-2835 trnR
3289 CALCXS010000063.1 GCA937906735_01637 gene open 2847-2920 trnR
3290 CALCXS010000063.1 GCA937906735_01636 tRNA open 2762-2835 trnR tRNA-Arg(acg)
3291 CALCXS010000063.1 GCA937906735_01637 tRNA open 2847-2920 trnR tRNA-Arg(acg)
3292 CALCXS010000064.1 GCA937906735_01647 CDS open 762-1439 _na     225_aa upp uracil phosphoribosyltransferase
3293 CALCXS010000064.1 GCA937906735_01648 CDS open 1464-1595 _na     43_aa hypothetical protein
3294 CALCXS010000064.1 GCA937906735_01649 CDS open 1919-3526 _na     535_aa pckA phosphoenolpyruvate carboxykinase (ATP)
3295 CALCXS010000064.1 GCA937906735_01650 CDS open 3794-4015 _na     73_aa DUF2795 domain-containing protein
3296 CALCXS010000064.1 GCA937906735_01651 CDS open 4746-5333 _na     195_aa hypothetical protein
3297 CALCXS010000064.1 GCA937906735_01652 CDS open 5830-7881 _na     683_aa Cytochrome C biogenesis protein transmembrane region
3298 CALCXS010000064.1 GCA937906735_01653 CDS open 8859-10109 _na     416_aa Lipocalin-like domain-containing protein
3299 CALCXS010000064.1 GCA937906735_01654 CDS open 10268-12763 _na     831_aa priA primosomal protein N'
3300 CALCXS010000064.1 GCA937906735_01655 CDS open 12874-13527 _na     217_aa ABC transporter ATP-binding protein
3301 CALCXS010000064.1 GCA937906735_01656 CDS open 13520-14359 _na     279_aa S1 motif domain-containing protein
3302 CALCXS010000064.1 GCA937906735_01657 CDS open 16884-18119 _na     411_aa Spi protease inhibitor domain-containing protein
3303 CALCXS010000064.1 GCA937906735_01658 CDS open 18492-19499 _na     335_aa NAD dependent epimerase/dehydratase family protein
3304 CALCXS010000064.1 GCA937906735_01659 CDS open 19508-21346 _na     612_aa ABC transporter%2C ATP-binding protein
3305 CALCXS010000064.1 GCA937906735_01660 CDS open 21478-22173 _na     231_aa Ribonuclease H
3306 CALCXS010000064.1 GCA937906735_01661 CDS open 22192-24009 _na     605_aa argS arginine--tRNA ligase
3307 CALCXS010000064.1 GCA937906735_01662 CDS open 24117-24929 _na     270_aa Acid phosphatase
3308 CALCXS010000064.1 GCA937906735_01663 CDS open 25203-26006 _na     267_aa hypothetical protein
3309 CALCXS010000064.1 GCA937906735_01647 gene open 762-1439 upp
3310 CALCXS010000064.1 GCA937906735_01648 gene open 1464-1595
3311 CALCXS010000064.1 GCA937906735_01649 gene open 1919-3526 pckA
3312 CALCXS010000064.1 GCA937906735_01650 gene open 3794-4015
3313 CALCXS010000064.1 GCA937906735_01651 gene open 4746-5333
3314 CALCXS010000064.1 GCA937906735_01652 gene open 5830-7881
3315 CALCXS010000064.1 GCA937906735_01653 gene open 8859-10109
3316 CALCXS010000064.1 GCA937906735_01654 gene open 10268-12763 priA
3317 CALCXS010000064.1 GCA937906735_01655 gene open 12874-13527
3318 CALCXS010000064.1 GCA937906735_01656 gene open 13520-14359
3319 CALCXS010000064.1 GCA937906735_01657 gene open 16884-18119
3320 CALCXS010000064.1 GCA937906735_01658 gene open 18492-19499
3321 CALCXS010000064.1 GCA937906735_01659 gene open 19508-21346
3322 CALCXS010000064.1 GCA937906735_01660 gene open 21478-22173
3323 CALCXS010000064.1 GCA937906735_01661 gene open 22192-24009 argS
3324 CALCXS010000064.1 GCA937906735_01662 gene open 24117-24929
3325 CALCXS010000064.1 GCA937906735_01663 gene open 25203-26006
3326 CALCXS010000065.1 GCA937906735_01664 CDS open 878-1219 _na     113_aa hypothetical protein
3327 CALCXS010000065.1 GCA937906735_01665 CDS open 1697-1819 _na     40_aa hypothetical protein
3328 CALCXS010000065.1 GCA937906735_01666 CDS open 1881-2693 _na     270_aa O-methyltransferase domain protein
3329 CALCXS010000065.1 GCA937906735_01667 CDS open 2732-3295 _na     187_aa Isoprenylcysteine carboxyl methyltransferase family protein
3330 CALCXS010000065.1 GCA937906735_01668 CDS open 4063-6249 _na     728_aa Fibronectin type-III domain-containing protein
3331 CALCXS010000065.1 GCA937906735_01664 gene open 878-1219
3332 CALCXS010000065.1 GCA937906735_01665 gene open 1697-1819
3333 CALCXS010000065.1 GCA937906735_01666 gene open 1881-2693
3334 CALCXS010000065.1 GCA937906735_01667 gene open 2732-3295
3335 CALCXS010000065.1 GCA937906735_01668 gene open 4063-6249
3336 CALCXS010000066.1 repeat_region open 56611-56792 CRISPR array with 3 repeats of length 40%2C consensus sequence TAGGTTGTGGTTTGATGTAGAAGAAGGATATAACACAACT and spacer length 26
3337 CALCXS010000066.1 GCA937906735_01670 CDS open 869-1954 _na     361_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
3338 CALCXS010000066.1 GCA937906735_01671 CDS open 2061-2495 _na     144_aa DUF5056 domain-containing protein
3339 CALCXS010000066.1 GCA937906735_01672 CDS open 2536-2877 _na     113_aa merR Transcriptional regulator%2C MerR family
3340 CALCXS010000066.1 GCA937906735_01673 CDS open 2874-4259 _na     461_aa radA DNA repair protein RadA
3341 CALCXS010000066.1 GCA937906735_01674 CDS open 4339-5964 _na     541_aa FAD-dependent protein C-terminal domain-containing protein
3342 CALCXS010000066.1 GCA937906735_01675 CDS open 6532-9717 _na     1061_aa DNA 3'-5' helicase
3343 CALCXS010000066.1 GCA937906735_01676 CDS open 9714-12431 _na     905_aa PD-(D/E)XK endonuclease-like domain-containing protein
3344 CALCXS010000066.1 GCA937906735_01677 CDS open 12440-13126 _na     228_aa B3/B4 tRNA-binding domain-containing protein
3345 CALCXS010000066.1 GCA937906735_01678 CDS open 13723-14202 _na     159_aa smpB SsrA-binding protein
3346 CALCXS010000066.1 GCA937906735_01679 CDS open 14189-14701 _na     170_aa DUF4375 domain-containing protein
3347 CALCXS010000066.1 GCA937906735_01680 CDS open 14931-15644 _na     237_aa hmuY HmuY protein
3348 CALCXS010000066.1 GCA937906735_01681 CDS open 15983-17251 _na     422_aa adenylosuccinate synthase
3349 CALCXS010000066.1 GCA937906735_01682 CDS open 17345-18463 _na     372_aa rfbB dTDP-glucose 4%2C6-dehydratase
3350 CALCXS010000066.1 GCA937906735_01683 CDS open 19123-20436 _na     437_aa DEAD/DEAH box helicase
3351 CALCXS010000066.1 GCA937906735_01684 CDS open 20529-23093 _na     854_aa Alpha-glucan phosphorylase
3352 CALCXS010000066.1 GCA937906735_01685 CDS open 23133-24791 _na     552_aa Starch synthase
3353 CALCXS010000066.1 GCA937906735_01686 CDS open 25400-26203 _na     267_aa ABC transporter%2C ATP-binding protein
3354 CALCXS010000066.1 GCA937906735_01687 CDS open 26216-28228 _na     670_aa DNA topoisomerase
3355 CALCXS010000066.1 GCA937906735_01688 CDS open 28346-28639 _na     97_aa DUF6965 domain-containing protein
3356 CALCXS010000066.1 GCA937906735_01689 CDS open 28662-30398 _na     578_aa lysS lysine--tRNA ligase
3357 CALCXS010000066.1 GCA937906735_01690 CDS open 30456-31448 _na     330_aa Glycerol-3-phosphate dehydrogenase
3358 CALCXS010000066.1 GCA937906735_01691 CDS open 32244-32813 _na     189_aa Lipoprotein
3359 CALCXS010000066.1 GCA937906735_01692 CDS open 33093-34811 _na     572_aa recJ single-stranded-DNA-specific exonuclease RecJ
3360 CALCXS010000066.1 GCA937906735_01693 CDS open 34804-36702 _na     632_aa recQ ATP-dependent DNA helicase RecQ
3361 CALCXS010000066.1 GCA937906735_01694 CDS open 36837-37484 _na     215_aa PAP2 family protein
3362 CALCXS010000066.1 GCA937906735_01695 CDS open 37518-37784 _na     88_aa hypothetical protein
3363 CALCXS010000066.1 GCA937906735_01696 CDS open 38143-39102 _na     319_aa Putative auto-transporter adhesin head GIN domain-containing protein
3364 CALCXS010000066.1 GCA937906735_01697 CDS open 39298-40794 _na     498_aa Glycosyl hydrolase-like 10 domain-containing protein
3365 CALCXS010000066.1 GCA937906735_01698 CDS open 41295-42092 _na     265_aa Scorpion calcine family
3366 CALCXS010000066.1 GCA937906735_01699 CDS open 42397-43788 _na     463_aa Threonine/serine exporter-like N-terminal domain-containing protein
3367 CALCXS010000066.1 GCA937906735_01700 CDS open 43867-44376 _na     169_aa Flavin reductase like domain-containing protein
3368 CALCXS010000066.1 GCA937906735_01701 CDS open 44797-45525 _na     242_aa DUF4827 domain-containing protein
3369 CALCXS010000066.1 GCA937906735_01703 CDS open 46034-48316 _na     760_aa Outer membrane protein%2C OMP85 family
3370 CALCXS010000066.1 GCA937906735_01704 CDS open 48390-49139 _na     249_aa trmH RNA methyltransferase%2C TrmH family
3371 CALCXS010000066.1 GCA937906735_01705 CDS open 49143-50324 _na     393_aa Glycosyltransferase%2C group 2 family protein
3372 CALCXS010000066.1 GCA937906735_01707 CDS open 51381-51566 _na     61_aa hypothetical protein
3373 CALCXS010000066.1 GCA937906735_01708 CDS open 51621-55292 _na     1223_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
3374 CALCXS010000066.1 GCA937906735_01709 CDS open 55297-56184 _na     295_aa cas1 type II CRISPR-associated endonuclease Cas1
3375 CALCXS010000066.1 GCA937906735_01710 CDS open 56181-56519 _na     112_aa cas2 CRISPR-associated endonuclease Cas2
3376 CALCXS010000066.1 GCA937906735_01711 CDS open 57607-57915 _na     102_aa hypothetical protein
3377 CALCXS010000066.1 GCA937906735_01670 gene open 869-1954 mnmA
3378 CALCXS010000066.1 GCA937906735_01671 gene open 2061-2495
3379 CALCXS010000066.1 GCA937906735_01672 gene open 2536-2877 merR
3380 CALCXS010000066.1 GCA937906735_01673 gene open 2874-4259 radA
3381 CALCXS010000066.1 GCA937906735_01674 gene open 4339-5964
3382 CALCXS010000066.1 GCA937906735_01675 gene open 6532-9717
3383 CALCXS010000066.1 GCA937906735_01676 gene open 9714-12431
3384 CALCXS010000066.1 GCA937906735_01677 gene open 12440-13126
3385 CALCXS010000066.1 GCA937906735_01678 gene open 13723-14202 smpB
3386 CALCXS010000066.1 GCA937906735_01679 gene open 14189-14701
3387 CALCXS010000066.1 GCA937906735_01680 gene open 14931-15644 hmuY
3388 CALCXS010000066.1 GCA937906735_01681 gene open 15983-17251
3389 CALCXS010000066.1 GCA937906735_01682 gene open 17345-18463 rfbB
3390 CALCXS010000066.1 GCA937906735_01683 gene open 19123-20436
3391 CALCXS010000066.1 GCA937906735_01684 gene open 20529-23093
3392 CALCXS010000066.1 GCA937906735_01685 gene open 23133-24791
3393 CALCXS010000066.1 GCA937906735_01686 gene open 25400-26203
3394 CALCXS010000066.1 GCA937906735_01687 gene open 26216-28228
3395 CALCXS010000066.1 GCA937906735_01688 gene open 28346-28639
3396 CALCXS010000066.1 GCA937906735_01689 gene open 28662-30398 lysS
3397 CALCXS010000066.1 GCA937906735_01690 gene open 30456-31448
3398 CALCXS010000066.1 GCA937906735_01691 gene open 32244-32813
3399 CALCXS010000066.1 GCA937906735_01692 gene open 33093-34811 recJ
3400 CALCXS010000066.1 GCA937906735_01693 gene open 34804-36702 recQ
3401 CALCXS010000066.1 GCA937906735_01694 gene open 36837-37484
3402 CALCXS010000066.1 GCA937906735_01695 gene open 37518-37784
3403 CALCXS010000066.1 GCA937906735_01696 gene open 38143-39102
3404 CALCXS010000066.1 GCA937906735_01697 gene open 39298-40794
3405 CALCXS010000066.1 GCA937906735_01698 gene open 41295-42092
3406 CALCXS010000066.1 GCA937906735_01699 gene open 42397-43788
3407 CALCXS010000066.1 GCA937906735_01700 gene open 43867-44376
3408 CALCXS010000066.1 GCA937906735_01701 gene open 44797-45525
3409 CALCXS010000066.1 GCA937906735_01703 gene open 46034-48316
3410 CALCXS010000066.1 GCA937906735_01704 gene open 48390-49139 trmH
3411 CALCXS010000066.1 GCA937906735_01705 gene open 49143-50324
3412 CALCXS010000066.1 GCA937906735_01707 gene open 51381-51566
3413 CALCXS010000066.1 GCA937906735_01708 gene open 51621-55292 cas9
3414 CALCXS010000066.1 GCA937906735_01709 gene open 55297-56184 cas1
3415 CALCXS010000066.1 GCA937906735_01710 gene open 56181-56519 cas2
3416 CALCXS010000066.1 GCA937906735_01711 gene open 57607-57915
3417 CALCXS010000066.1 GCA937906735_01669 gene open 699-773 trnP
3418 CALCXS010000066.1 GCA937906735_01702 gene open 45887-45957 trnC
3419 CALCXS010000066.1 GCA937906735_01706 gene open 50994-51066 trnK
3420 CALCXS010000066.1 GCA937906735_01669 tRNA open 699-773 trnP tRNA-Pro(ggg)
3421 CALCXS010000066.1 GCA937906735_01702 tRNA open 45887-45957 trnC tRNA-Cys(gca)
3422 CALCXS010000066.1 GCA937906735_01706 tRNA open 50994-51066 trnK tRNA-Lys(ttt)
3423 CALCXS010000067.1 GCA937906735_01712 CDS open 1037-5140 _na     1367_aa DNA methylase adenine-specific domain-containing protein
3424 CALCXS010000067.1 GCA937906735_01713 CDS open 5130-5648 _na     172_aa DUF1896 domain-containing protein
3425 CALCXS010000067.1 GCA937906735_01714 CDS open 5821-7911 _na     696_aa topA DNA topoisomerase
3426 CALCXS010000067.1 GCA937906735_01715 CDS open 7971-9548 _na     525_aa DUF3945 domain-containing protein
3427 CALCXS010000067.1 GCA937906735_01716 CDS open 9568-9918 _na     116_aa Helix-turn-helix domain-containing protein
3428 CALCXS010000067.1 GCA937906735_01717 CDS open 9922-10314 _na     130_aa DNA binding domain%2C excisionase family
3429 CALCXS010000067.1 GCA937906735_01718 CDS open 10565-10858 _na     97_aa DNA-binding helix-turn-helix protein
3430 CALCXS010000067.1 GCA937906735_01719 CDS open 10895-11203 _na     102_aa Helix-turn-helix domain-containing protein
3431 CALCXS010000067.1 GCA937906735_01720 CDS open 11295-11657 _na     120_aa rhuM RhuM protein
3432 CALCXS010000067.1 GCA937906735_01721 CDS open 11671-13023 _na     450_aa Tyr recombinase domain-containing protein
3433 CALCXS010000067.1 GCA937906735_01723 CDS open 13938-15689 _na     583_aa 5'-nucleotidase%2C C-terminal domain protein
3434 CALCXS010000067.1 GCA937906735_01724 CDS open 15709-16245 _na     178_aa Dihydrofolate reductase
3435 CALCXS010000067.1 GCA937906735_01725 CDS open 16199-16993 _na     264_aa thymidylate synthase
3436 CALCXS010000067.1 GCA937906735_01726 CDS open 17251-17631 _na     126_aa MmcQ/YjbR family DNA-binding protein
3437 CALCXS010000067.1 GCA937906735_01727 CDS open 18218-18670 _na     150_aa RNA polymerase sigma factor%2C sigma-70 family
3438 CALCXS010000067.1 GCA937906735_01728 CDS open 18648-19094 _na     148_aa Tat pathway signal sequence domain protein
3439 CALCXS010000067.1 GCA937906735_01729 CDS open 19131-19550 _na     139_aa DUF4252 domain-containing protein
3440 CALCXS010000067.1 GCA937906735_01730 CDS open 19620-20507 _na     295_aa Outer membrane protein beta-barrel domain-containing protein
3441 CALCXS010000067.1 GCA937906735_01731 CDS open 20987-24172 _na     1061_aa TonB-dependent receptor-like beta-barrel domain-containing protein
3442 CALCXS010000067.1 GCA937906735_01732 CDS open 24346-24786 _na     146_aa Hsp20/alpha crystallin family protein
3443 CALCXS010000067.1 GCA937906735_01733 CDS open 25592-27133 _na     513_aa glycine--tRNA ligase
3444 CALCXS010000067.1 GCA937906735_01734 CDS open 27203-27817 _na     204_aa Peptidyl-prolyl cis-trans isomerase
3445 CALCXS010000067.1 GCA937906735_01735 CDS open 28022-28441 _na     139_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
3446 CALCXS010000067.1 GCA937906735_01736 CDS open 28907-29224 _na     105_aa rplU 50S ribosomal protein L21
3447 CALCXS010000067.1 GCA937906735_01737 CDS open 29954-34420 _na     1488_aa Cleaved adhesin domain-containing protein
3448 CALCXS010000067.1 GCA937906735_01738 CDS open 35667-40157 _na     1496_aa Cleaved adhesin domain-containing protein
3449 CALCXS010000067.1 GCA937906735_01739 CDS open 41441-42154 _na     237_aa porT PorT protein
3450 CALCXS010000067.1 GCA937906735_01740 CDS open 42356-43363 _na     335_aa yeiH YeiH family sulfate export transporter
3451 CALCXS010000067.1 GCA937906735_01741 CDS open 43612-45045 _na     477_aa Putative aspartate ammonia-lyase
3452 CALCXS010000067.1 GCA937906735_01742 CDS open 45398-46471 _na     357_aa Phosphate-selective porin O and P
3453 CALCXS010000067.1 GCA937906735_01743 CDS open 47402-48199 _na     265_aa DKNYY family protein
3454 CALCXS010000067.1 GCA937906735_01744 CDS open 48378-49046 _na     222_aa hypothetical protein
3455 CALCXS010000067.1 GCA937906735_01745 CDS open 49131-49946 _na     271_aa DKNYY family protein
3456 CALCXS010000067.1 GCA937906735_01746 CDS open 50312-53725 _na     1137_aa ileS isoleucine--tRNA ligase
3457 CALCXS010000067.1 GCA937906735_01747 CDS open 53750-54166 _na     138_aa Zinc finger DksA/TraR C4-type domain-containing protein
3458 CALCXS010000067.1 GCA937906735_01748 CDS open 54178-54894 _na     238_aa lipoprotein signal peptidase
3459 CALCXS010000067.1 GCA937906735_01749 CDS open 54976-55803 _na     275_aa DUF4296 domain-containing protein
3460 CALCXS010000067.1 GCA937906735_01750 CDS open 56334-57473 _na     379_aa Lipocalin-like domain-containing protein
3461 CALCXS010000067.1 GCA937906735_01751 CDS open 58045-59388 _na     447_aa Cell surface protein
3462 CALCXS010000067.1 GCA937906735_01712 gene open 1037-5140
3463 CALCXS010000067.1 GCA937906735_01713 gene open 5130-5648
3464 CALCXS010000067.1 GCA937906735_01714 gene open 5821-7911 topA
3465 CALCXS010000067.1 GCA937906735_01715 gene open 7971-9548
3466 CALCXS010000067.1 GCA937906735_01716 gene open 9568-9918
3467 CALCXS010000067.1 GCA937906735_01717 gene open 9922-10314
3468 CALCXS010000067.1 GCA937906735_01718 gene open 10565-10858
3469 CALCXS010000067.1 GCA937906735_01719 gene open 10895-11203
3470 CALCXS010000067.1 GCA937906735_01720 gene open 11295-11657 rhuM
3471 CALCXS010000067.1 GCA937906735_01721 gene open 11671-13023
3472 CALCXS010000067.1 GCA937906735_01723 gene open 13938-15689
3473 CALCXS010000067.1 GCA937906735_01724 gene open 15709-16245
3474 CALCXS010000067.1 GCA937906735_01725 gene open 16199-16993
3475 CALCXS010000067.1 GCA937906735_01726 gene open 17251-17631
3476 CALCXS010000067.1 GCA937906735_01727 gene open 18218-18670
3477 CALCXS010000067.1 GCA937906735_01728 gene open 18648-19094
3478 CALCXS010000067.1 GCA937906735_01729 gene open 19131-19550
3479 CALCXS010000067.1 GCA937906735_01730 gene open 19620-20507
3480 CALCXS010000067.1 GCA937906735_01731 gene open 20987-24172
3481 CALCXS010000067.1 GCA937906735_01732 gene open 24346-24786
3482 CALCXS010000067.1 GCA937906735_01733 gene open 25592-27133
3483 CALCXS010000067.1 GCA937906735_01734 gene open 27203-27817
3484 CALCXS010000067.1 GCA937906735_01735 gene open 28022-28441 tsaE
3485 CALCXS010000067.1 GCA937906735_01736 gene open 28907-29224 rplU
3486 CALCXS010000067.1 GCA937906735_01737 gene open 29954-34420
3487 CALCXS010000067.1 GCA937906735_01738 gene open 35667-40157
3488 CALCXS010000067.1 GCA937906735_01739 gene open 41441-42154 porT
3489 CALCXS010000067.1 GCA937906735_01740 gene open 42356-43363 yeiH
3490 CALCXS010000067.1 GCA937906735_01741 gene open 43612-45045
3491 CALCXS010000067.1 GCA937906735_01742 gene open 45398-46471
3492 CALCXS010000067.1 GCA937906735_01743 gene open 47402-48199
3493 CALCXS010000067.1 GCA937906735_01744 gene open 48378-49046
3494 CALCXS010000067.1 GCA937906735_01745 gene open 49131-49946
3495 CALCXS010000067.1 GCA937906735_01746 gene open 50312-53725 ileS
3496 CALCXS010000067.1 GCA937906735_01747 gene open 53750-54166
3497 CALCXS010000067.1 GCA937906735_01748 gene open 54178-54894
3498 CALCXS010000067.1 GCA937906735_01749 gene open 54976-55803
3499 CALCXS010000067.1 GCA937906735_01750 gene open 56334-57473
3500 CALCXS010000067.1 GCA937906735_01751 gene open 58045-59388