BAKTAGenome Explorer: Arthrospira platensis (GCA_000210375.1)
Select a Genome:
|
BAKTA Annotations for GCA_000210375.1
|
Search & Sort all 12597 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | AP011615.1 | GCA000210375_04846 | gene | open | 5181842-5182233 | ssrA | ||
| 2 | AP011615.1 | GCA000210375_04846 | tmRNA | open | 5181842-5182233 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | AP011615.1 | GCA000210375_00113 | gene | open | 121645-121822 | isrR | ||
| 4 | AP011615.1 | GCA000210375_01244 | gene | open | 1286708-1286923 | HEARO | ||
| 5 | AP011615.1 | GCA000210375_01267 | gene | open | 1314284-1314340 | nsiR1 | ||
| 6 | AP011615.1 | GCA000210375_01764 | gene | open | 1887330-1887387 | nsiR1 | ||
| 7 | AP011615.1 | GCA000210375_02444 | gene | open | 2580019-2582901 | rrl | ||
| 8 | AP011615.1 | GCA000210375_02447 | gene | open | 2583379-2584867 | rrs | ||
| 9 | AP011615.1 | GCA000210375_02482 | gene | open | 2630885-2631001 | rrf | ||
| 10 | AP011615.1 | GCA000210375_02594 | gene | open | 2770906-2771104 | HEARO | ||
| 11 | AP011615.1 | GCA000210375_02613 | gene | open | 2791752-2791953 | HEARO | ||
| 12 | AP011615.1 | GCA000210375_02861 | gene | open | 3024635-3024921 | 5_ureB_sRNA | ||
| 13 | AP011615.1 | GCA000210375_02880 | gene | open | 3049570-3049635 | Yfr1 | ||
| 14 | AP011615.1 | GCA000210375_03014 | gene | open | 3180809-3180995 | isrR | ||
| 15 | AP011615.1 | GCA000210375_03287 | gene | open | 3504770-3507652 | rrl | ||
| 16 | AP011615.1 | GCA000210375_03290 | gene | open | 3508130-3509618 | rrs | ||
| 17 | AP011615.1 | GCA000210375_03924 | gene | open | 4162103-4162154 | nsiR1 | ||
| 18 | AP011615.1 | GCA000210375_04020 | gene | open | 4276433-4276549 | rrf | ||
| 19 | AP011615.1 | GCA000210375_04040 | gene | open | 4304701-4305082 | RNaseP_bact_a | ||
| 20 | AP011615.1 | GCA000210375_04158 | gene | open | 4457510-4457694 | 6S | ||
| 21 | AP011615.1 | GCA000210375_04233 | gene | open | 4544969-4545202 | HEARO | ||
| 22 | AP011615.1 | GCA000210375_04360 | gene | open | 4662443-4662539 | Bacteria_small_SRP | ||
| 23 | AP011615.1 | GCA000210375_04620 | gene | open | 4926117-4926323 | HEARO | ||
| 24 | AP011615.1 | GCA000210375_04679 | gene | open | 4991248-4991496 | HEARO | ||
| 25 | AP011615.1 | GCA000210375_04789 | gene | open | 5128057-5128131 | Cyano-1 | ||
| 26 | AP011615.1 | GCA000210375_04906 | gene | open | 5261183-5261398 | HEARO | ||
| 27 | AP011615.1 | GCA000210375_00113 | ncRNA | open | 121645-121822 | isrR | Antisense RNA which regulates isiA expression | |
| 28 | AP011615.1 | GCA000210375_01244 | ncRNA | open | 1286708-1286923 | HNH endonuclease-associated RNA and ORF (HEARO) RNA | ||
| 29 | AP011615.1 | GCA000210375_01267 | ncRNA | open | 1314284-1314340 | nsiR1 | Nitrogen stress-induced RNA 1 | |
| 30 | AP011615.1 | GCA000210375_01764 | ncRNA | open | 1887330-1887387 | nsiR1 | Nitrogen stress-induced RNA 1 | |
| 31 | AP011615.1 | GCA000210375_02594 | ncRNA | open | 2770906-2771104 | HNH endonuclease-associated RNA and ORF (HEARO) RNA | ||
| 32 | AP011615.1 | GCA000210375_02613 | ncRNA | open | 2791752-2791953 | HNH endonuclease-associated RNA and ORF (HEARO) RNA | ||
| 33 | AP011615.1 | GCA000210375_02861 | ncRNA | open | 3024635-3024921 | 5' ureB small RNA | ||
| 34 | AP011615.1 | GCA000210375_02880 | ncRNA | open | 3049570-3049635 | Cyanobacterial functional RNA 1 | ||
| 35 | AP011615.1 | GCA000210375_03014 | ncRNA | open | 3180809-3180995 | isrR | Antisense RNA which regulates isiA expression | |
| 36 | AP011615.1 | GCA000210375_03924 | ncRNA | open | 4162103-4162154 | nsiR1 | Nitrogen stress-induced RNA 1 | |
| 37 | AP011615.1 | GCA000210375_04040 | ncRNA | open | 4304701-4305082 | Bacterial RNase P class A | ||
| 38 | AP011615.1 | GCA000210375_04158 | ncRNA | open | 4457510-4457694 | 6S / SsrS RNA | ||
| 39 | AP011615.1 | GCA000210375_04233 | ncRNA | open | 4544969-4545202 | HNH endonuclease-associated RNA and ORF (HEARO) RNA | ||
| 40 | AP011615.1 | GCA000210375_04360 | ncRNA | open | 4662443-4662539 | Bacterial small signal recognition particle RNA | ||
| 41 | AP011615.1 | GCA000210375_04620 | ncRNA | open | 4926117-4926323 | HNH endonuclease-associated RNA and ORF (HEARO) RNA | ||
| 42 | AP011615.1 | GCA000210375_04679 | ncRNA | open | 4991248-4991496 | HNH endonuclease-associated RNA and ORF (HEARO) RNA | ||
| 43 | AP011615.1 | GCA000210375_04789 | ncRNA | open | 5128057-5128131 | Cyano-1 RNA | ||
| 44 | AP011615.1 | GCA000210375_04906 | ncRNA | open | 5261183-5261398 | HNH endonuclease-associated RNA and ORF (HEARO) RNA | ||
| 45 | AP011615.1 | regulatory_region | open | 293960-294056 | TPP riboswitch aptamer (THI element) | |||
| 46 | AP011615.1 | regulatory_region | open | 368027-368199 | Ribosomal protein L10 leader | |||
| 47 | AP011615.1 | regulatory_region | open | 3150236-3150327 | Glutamine riboswitch aptamer (glnA leader) | |||
| 48 | AP011615.1 | regulatory_region | open | 3690048-3690209 | c-di-AMP riboswitch aptamer (ydaO/yuaA leader) | |||
| 49 | AP011615.1 | regulatory_region | open | 5289622-5289782 | Cobalamin riboswitch aptamer | |||
| 50 | AP011615.1 | GCA000210375_02444 | rRNA | open | 2580019-2582901 | rrl | 23S ribosomal RNA | |
| 51 | AP011615.1 | GCA000210375_02447 | rRNA | open | 2583379-2584867 | rrs | 16S ribosomal RNA | |
| 52 | AP011615.1 | GCA000210375_02482 | rRNA | open | 2630885-2631001 | rrf | 5S ribosomal RNA | |
| 53 | AP011615.1 | GCA000210375_03287 | rRNA | open | 3504770-3507652 | rrl | 23S ribosomal RNA | |
| 54 | AP011615.1 | GCA000210375_03290 | rRNA | open | 3508130-3509618 | rrs | 16S ribosomal RNA | |
| 55 | AP011615.1 | GCA000210375_04020 | rRNA | open | 4276433-4276549 | rrf | 5S ribosomal RNA | |
| 56 | AP011615.1 | repeat_region | open | 2549389-2549619 | CRISPR array with 3 repeats of length 51%2C consensus sequence GGTTCTGCTGTTAATTAATCGGACCACCAGAAGATTAATAAACCCGCCCGC and spacer length 16 | |||
| 57 | AP011615.1 | repeat_region | open | 2897528-2897938 | CRISPR array with 6 repeats of length 35%2C consensus sequence GTTTCCATACGTTTAACTTTCAAAGAAGTTTAAAG and spacer length 38 | |||
| 58 | AP011615.1 | repeat_region | open | 2903162-2904089 | CRISPR array with 13 repeats of length 35%2C consensus sequence GTTTCCATACGTTTAACTTTCAGAGAAGTCTAAAG and spacer length 38 | |||
| 59 | AP011615.1 | repeat_region | open | 3587555-3589807 | CRISPR array with 29 repeats of length 37%2C consensus sequence GTTTCCGTCCCCTTGCGGGGAATTGGTAGGGTTGGAC and spacer length 41 | |||
| 60 | AP011615.1 | repeat_region | open | 4222944-4223300 | CRISPR array with 5 repeats of length 37%2C consensus sequence GTTTCCGTCCCCTGGCGCTTAATTGGTAGGGTCTGAC and spacer length 40 | |||
| 61 | AP011615.1 | repeat_region | open | 4223329-4225601 | CRISPR array with 29 repeats of length 37%2C consensus sequence GTTTCCGTCCCCTTGCGGGGAATTGGTAGGGTCTGAC and spacer length 42 | |||
| 62 | AP011615.1 | repeat_region | open | 4296783-4297694 | CRISPR array with 12 repeats of length 37%2C consensus sequence GTCAGACCCTACCAATTCCCCGCAAGGGGACGGAAAC and spacer length 41 | |||
| 63 | AP011615.1 | repeat_region | open | 4297860-4298464 | CRISPR array with 8 repeats of length 37%2C consensus sequence GTCAGACCCTACCAATTCCCCGCAAGGGGACGGAAAC and spacer length 42 | |||
| 64 | AP011615.1 | repeat_region | open | 4298655-4300760 | CRISPR array with 27 repeats of length 37%2C consensus sequence GTCAGACCCTACCAATTCCCCGCAAGGGGACGGAAAC and spacer length 42 | |||
| 65 | AP011615.1 | repeat_region | open | 5189874-5191463 | CRISPR array with 23 repeats of length 35%2C consensus sequence GTTGCCATACGTTCGACTTTCAAAGAAGTCTCAAG and spacer length 35 | |||
| 66 | AP011615.1 | GCA000210375_00001 | CDS | open | 377-724 | _na 115_aa | hypothetical protein | |
| 67 | AP011615.1 | GCA000210375_00002 | CDS | open | 769-1443 | _na 224_aa | HAD family hydrolase | |
| 68 | AP011615.1 | GCA000210375_00003 | CDS | open | 1443-2099 | _na 218_aa | cytidylyltransferase domain-containing protein | |
| 69 | AP011615.1 | GCA000210375_00004 | CDS | open | 2106-2849 | _na 247_aa | HpcH/HpaI aldolase/citrate lyase family protein | |
| 70 | AP011615.1 | GCA000210375_00005 | CDS | open | 2861-4507 | _na 548_aa | Pyruvate carboxyltransferase | |
| 71 | AP011615.1 | GCA000210375_00006 | CDS | open | 4540-7719 | _na 1059_aa | tetratricopeptide repeat protein | |
| 72 | AP011615.1 | GCA000210375_00007 | CDS | open | 8370-9119 | _na 249_aa | hypothetical protein | |
| 73 | AP011615.1 | GCA000210375_00008 | CDS | open | 9741-10238 | _na 165_aa | J domain-containing protein | |
| 74 | AP011615.1 | GCA000210375_00009 | CDS | open | 10255-10788 | _na 177_aa | hypothetical protein | |
| 75 | AP011615.1 | GCA000210375_00010 | CDS | open | 10936-11433 | _na 165_aa | J domain-containing protein | |
| 76 | AP011615.1 | GCA000210375_00011 | CDS | open | 11450-11974 | _na 174_aa | hypothetical protein | |
| 77 | AP011615.1 | GCA000210375_00012 | CDS | open | 12230-12484 | _na 84_aa | hicB | HicB-like antitoxin of toxin-antitoxin system domain-containing protein |
| 78 | AP011615.1 | GCA000210375_00013 | CDS | open | 12481-12714 | _na 77_aa | hicA | type II toxin-antitoxin system HicA family toxin |
| 79 | AP011615.1 | GCA000210375_00014 | CDS | open | 12659-12979 | _na 106_aa | hypothetical protein | |
| 80 | AP011615.1 | GCA000210375_00015 | CDS | open | 12948-13619 | _na 223_aa | PD-(D/E)XK nuclease superfamily | |
| 81 | AP011615.1 | GCA000210375_00016 | CDS | open | 13897-14826 | _na 309_aa | M48 family metallopeptidase | |
| 82 | AP011615.1 | GCA000210375_00017 | CDS | open | 15146-15283 | _na 45_aa | hypothetical protein | |
| 83 | AP011615.1 | GCA000210375_00018 | CDS | open | 15596-16216 | _na 206_aa | Nucleotidyl transferase AbiEii/AbiGii toxin family protein | |
| 84 | AP011615.1 | GCA000210375_00019 | CDS | open | 16137-16652 | _na 171_aa | hypothetical protein | |
| 85 | AP011615.1 | GCA000210375_00020 | CDS | open | 16848-17126 | _na 92_aa | putative protein family (UPF0175) | |
| 86 | AP011615.1 | GCA000210375_00021 | CDS | open | 17123-17614 | _na 163_aa | Nucleic acid-binding protein | |
| 87 | AP011615.1 | GCA000210375_00022 | CDS | open | 17916-18566 | _na 216_aa | PD-(D/E)XK nuclease superfamily | |
| 88 | AP011615.1 | GCA000210375_00023 | CDS | open | 18616-19134 | _na 172_aa | hypothetical protein | |
| 89 | AP011615.1 | GCA000210375_00024 | CDS | open | 19211-20305 | _na 364_aa | Iron-containing alcohol dehydrogenase | |
| 90 | AP011615.1 | GCA000210375_00025 | CDS | open | 20457-21581 | _na 374_aa | aepY | phosphonopyruvate decarboxylase |
| 91 | AP011615.1 | GCA000210375_00026 | CDS | open | 21593-22891 | _na 432_aa | aepX | phosphoenolpyruvate mutase |
| 92 | AP011615.1 | GCA000210375_00027 | CDS | open | 22975-24600 | _na 541_aa | TPR repeat-containing protein | |
| 93 | AP011615.1 | GCA000210375_00028 | CDS | open | 24995-25891 | _na 298_aa | hypothetical protein | |
| 94 | AP011615.1 | GCA000210375_00029 | CDS | open | 25860-26543 | _na 227_aa | DUF3782 domain-containing protein | |
| 95 | AP011615.1 | GCA000210375_00030 | CDS | open | 26904-27143 | _na 79_aa | hicA | type II toxin-antitoxin system HicA family toxin |
| 96 | AP011615.1 | GCA000210375_00031 | CDS | open | 27161-27373 | _na 70_aa | 2-oxoisovalerate dehydrogenase%2C E1 component beta subunit | |
| 97 | AP011615.1 | GCA000210375_00032 | CDS | open | 27543-27917 | _na 124_aa | hypothetical protein | |
| 98 | AP011615.1 | GCA000210375_00033 | CDS | open | 27886-28503 | _na 205_aa | PD-(D/E)XK nuclease superfamily | |
| 99 | AP011615.1 | GCA000210375_00034 | CDS | open | 28774-29013 | _na 79_aa | hicA | type II toxin-antitoxin system HicA family toxin |
| 100 | AP011615.1 | GCA000210375_00035 | CDS | open | 29031-29243 | _na 70_aa | 2-oxoisovalerate dehydrogenase%2C E1 component beta subunit | |
| 101 | AP011615.1 | GCA000210375_00036 | CDS | open | 29301-29762 | _na 153_aa | hypothetical protein | |
| 102 | AP011615.1 | GCA000210375_00037 | CDS | open | 29756-30397 | _na 213_aa | DUF3782 domain-containing protein | |
| 103 | AP011615.1 | GCA000210375_00038 | CDS | open | 30492-30677 | _na 61_aa | hypothetical protein | |
| 104 | AP011615.1 | GCA000210375_00039 | CDS | open | 30671-31309 | _na 212_aa | PD-(D/E)XK nuclease superfamily | |
| 105 | AP011615.1 | GCA000210375_00040 | CDS | open | 31559-32644 | _na 361_aa | hypothetical protein | |
| 106 | AP011615.1 | GCA000210375_00041 | CDS | open | 32687-33784 | _na 365_aa | fkbM | Methyltransferase FkbM domain-containing protein |
| 107 | AP011615.1 | GCA000210375_00042 | CDS | open | 33852-34877 | _na 341_aa | hypothetical protein | |
| 108 | AP011615.1 | GCA000210375_00043 | CDS | open | 34951-35445 | _na 164_aa | hypothetical protein | |
| 109 | AP011615.1 | GCA000210375_00044 | CDS | open | 35499-35864 | _na 121_aa | hypothetical protein | |
| 110 | AP011615.1 | GCA000210375_00045 | CDS | open | 35914-42759 | _na 2281_aa | hypothetical protein | |
| 111 | AP011615.1 | GCA000210375_00046 | CDS | open | 42796-43647 | _na 283_aa | hypothetical protein | |
| 112 | AP011615.1 | GCA000210375_00047 | CDS | open | 43652-44485 | _na 277_aa | DUF4351 domain-containing protein | |
| 113 | AP011615.1 | GCA000210375_00048 | CDS | open | 44475-45113 | _na 212_aa | hypothetical protein | |
| 114 | AP011615.1 | GCA000210375_00049 | CDS | open | 45140-46147 | _na 335_aa | DUF4351 domain-containing protein | |
| 115 | AP011615.1 | GCA000210375_00050 | CDS | open | 46174-47205 | _na 343_aa | DUF4351 domain-containing protein | |
| 116 | AP011615.1 | GCA000210375_00051 | CDS | open | 47210-48223 | _na 337_aa | DUF4351 domain-containing protein | |
| 117 | AP011615.1 | GCA000210375_00052 | CDS | open | 48240-49178 | _na 312_aa | DUF4351 domain-containing protein | |
| 118 | AP011615.1 | GCA000210375_00053 | CDS | open | 49195-50673 | _na 492_aa | hypothetical protein | |
| 119 | AP011615.1 | GCA000210375_00054 | CDS | open | 50718-51761 | _na 347_aa | DUF4351 domain-containing protein | |
| 120 | AP011615.1 | GCA000210375_00055 | CDS | open | 51788-52777 | _na 329_aa | DUF4351 domain-containing protein | |
| 121 | AP011615.1 | GCA000210375_00056 | CDS | open | 52803-54656 | _na 617_aa | putative capsular polysaccharide synthesis family protein | |
| 122 | AP011615.1 | GCA000210375_00057 | CDS | open | 54644-55675 | _na 343_aa | DUF268 domain-containing protein | |
| 123 | AP011615.1 | GCA000210375_00058 | CDS | open | 55739-56962 | _na 407_aa | class I SAM-dependent methyltransferase | |
| 124 | AP011615.1 | GCA000210375_00059 | CDS | open | 57007-58071 | _na 354_aa | NAD-dependent epimerase/dehydratase family protein | |
| 125 | AP011615.1 | GCA000210375_00060 | CDS | open | 58148-60931 | _na 927_aa | tetratricopeptide repeat protein | |
| 126 | AP011615.1 | GCA000210375_00061 | CDS | open | 61010-61798 | _na 262_aa | methyltransferase domain-containing protein | |
| 127 | AP011615.1 | GCA000210375_00062 | CDS | open | 61894-64761 | _na 955_aa | glycosyltransferase | |
| 128 | AP011615.1 | GCA000210375_00063 | CDS | open | 65001-65744 | _na 247_aa | fabG | Cell-cell signalling protein CsgA-like (Oxidoreductase%2C short chain dehydrogenase/reductase SDR family) |
| 129 | AP011615.1 | GCA000210375_00064 | CDS | open | 65866-67005 | _na 379_aa | corB | CBS domain containing protein |
| 130 | AP011615.1 | GCA000210375_00067 | CDS | open | 67462-68595 | _na 377_aa | rfaB | Mannosyltransferase |
| 131 | AP011615.1 | GCA000210375_00068 | CDS | open | 68635-69819 | _na 394_aa | rfaB | Glycosyl transferase group 1 |
| 132 | AP011615.1 | GCA000210375_00069 | CDS | open | 69851-70843 | _na 330_aa | hpsN | hormogonium polysaccharide biosynthesis glycosyltransferase HpsN |
| 133 | AP011615.1 | GCA000210375_00070 | CDS | open | 70850-71482 | _na 210_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 134 | AP011615.1 | GCA000210375_00071 | CDS | open | 71508-72551 | _na 347_aa | csaB | polysaccharide pyruvyl transferase CsaB |
| 135 | AP011615.1 | GCA000210375_00072 | CDS | open | 72751-72978 | _na 75_aa | hypothetical protein | |
| 136 | AP011615.1 | GCA000210375_00073 | CDS | open | 73377-75290 | _na 637_aa | arsA | Arsenite-activated ATPase ArsA |
| 137 | AP011615.1 | GCA000210375_00074 | CDS | open | 75469-76137 | _na 222_aa | yopM | Rab family protein |
| 138 | AP011615.1 | GCA000210375_00075 | CDS | open | 76181-76810 | _na 209_aa | DUF1361 domain-containing protein | |
| 139 | AP011615.1 | GCA000210375_00076 | CDS | open | 76880-78250 | _na 456_aa | cobyrinate a%2Cc-diamide synthase | |
| 140 | AP011615.1 | GCA000210375_00077 | CDS | open | 78295-78876 | _na 193_aa | DUF5357 domain-containing protein | |
| 141 | AP011615.1 | GCA000210375_00078 | CDS | open | 78878-79396 | _na 172_aa | fraC | filament integrity protein FraC |
| 142 | AP011615.1 | GCA000210375_00079 | CDS | open | 79541-80467 | _na 308_aa | Peptidase M28 | |
| 143 | AP011615.1 | GCA000210375_00080 | CDS | open | 80481-81806 | _na 441_aa | ubiG | Methyltransferase domain-containing protein |
| 144 | AP011615.1 | GCA000210375_00081 | CDS | open | 82092-84836 | _na 914_aa | apcE | Phycobiliprotein ApcE |
| 145 | AP011615.1 | GCA000210375_00082 | CDS | open | 84909-85529 | _na 206_aa | dedA | VTT domain-containing protein |
| 146 | AP011615.1 | GCA000210375_00083 | CDS | open | 85831-86166 | _na 111_aa | sTAS | Anti-sigma factor antagonist |
| 147 | AP011615.1 | GCA000210375_00084 | CDS | open | 86217-88484 | _na 755_aa | Protein-arginine deiminase | |
| 148 | AP011615.1 | GCA000210375_00085 | CDS | open | 88528-89100 | _na 190_aa | Abortive infection protein | |
| 149 | AP011615.1 | GCA000210375_00086 | CDS | open | 89130-90293 | _na 387_aa | perM | AI-2E family transporter |
| 150 | AP011615.1 | GCA000210375_00087 | CDS | open | 90283-91197 | _na 304_aa | ldcA | Peptidase U61%2C LD-carboxypeptidase A |
| 151 | AP011615.1 | GCA000210375_00088 | CDS | open | 91425-92225 | _na 266_aa | PEP-CTERM protein-sorting domain-containing protein | |
| 152 | AP011615.1 | GCA000210375_00089 | CDS | open | 92451-93101 | _na 216_aa | PEP-CTERM sorting domain-containing protein | |
| 153 | AP011615.1 | GCA000210375_00090 | CDS | open | 93369-94016 | _na 215_aa | PEP-CTERM protein-sorting domain-containing protein | |
| 154 | AP011615.1 | GCA000210375_00091 | CDS | open | 94966-96468 | _na 500_aa | Glycosyl hydrolase family 57 | |
| 155 | AP011615.1 | GCA000210375_00092 | CDS | open | 96542-97273 | _na 243_aa | sfsA | DNA/RNA nuclease SfsA |
| 156 | AP011615.1 | GCA000210375_00093 | CDS | open | 97325-100378 | _na 1017_aa | tlcC | Cyclic nucleotide-binding protein |
| 157 | AP011615.1 | GCA000210375_00094 | CDS | open | 100603-101865 | _na 420_aa | narK | Oxalate-formate exchanger/antiporter |
| 158 | AP011615.1 | GCA000210375_00095 | CDS | open | 101932-103605 | _na 557_aa | Peptidase S15 | |
| 159 | AP011615.1 | GCA000210375_00096 | CDS | open | 104057-104473 | _na 138_aa | abrB | Transcriptional regulator%2C AbrB family |
| 160 | AP011615.1 | GCA000210375_00097 | CDS | open | 104494-104754 | _na 86_aa | hypothetical protein | |
| 161 | AP011615.1 | GCA000210375_00098 | CDS | open | 105095-106498 | _na 467_aa | selO | Protein adenylyltransferase SelO |
| 162 | AP011615.1 | GCA000210375_00099 | CDS | open | 106615-107466 | _na 283_aa | mscK | Mechanosensitive ion channel family protein |
| 163 | AP011615.1 | GCA000210375_00100 | CDS | open | 107469-108746 | _na 425_aa | marR | MarR family transcriptional regulator |
| 164 | AP011615.1 | GCA000210375_00101 | CDS | open | 108779-110902 | _na 707_aa | glgX | glycogen debranching protein GlgX |
| 165 | AP011615.1 | GCA000210375_00102 | CDS | open | 110928-111962 | _na 344_aa | ttcA | tRNA(Ile)-lysidine synthase |
| 166 | AP011615.1 | GCA000210375_00103 | CDS | open | 112064-113104 | _na 346_aa | wcaA | Undecaprenyl phosphate-L-Ara4FN transferase Glycosyl transferase%2C family 2 Dolichol-phosphate mannosyltransferase |
| 167 | AP011615.1 | GCA000210375_00104 | CDS | open | 113876-114265 | _na 129_aa | hypothetical protein | |
| 168 | AP011615.1 | GCA000210375_00105 | CDS | open | 114426-116042 | _na 538_aa | leuA | 2-isopropylmalate synthase |
| 169 | AP011615.1 | GCA000210375_00106 | CDS | open | 116076-116597 | _na 173_aa | labA | NYN domain-containing protein |
| 170 | AP011615.1 | GCA000210375_00107 | CDS | open | 117280-117930 | _na 216_aa | ompR | Two-component system transcriptional regulator (BaeR) |
| 171 | AP011615.1 | GCA000210375_00108 | CDS | open | 118085-118576 | _na 163_aa | 2Fe2S | Ferredoxin-like protein |
| 172 | AP011615.1 | GCA000210375_00109 | CDS | open | 118854-119165 | _na 103_aa | groES | co-chaperone GroES |
| 173 | AP011615.1 | GCA000210375_00110 | CDS | open | 119275-120912 | _na 545_aa | groL | chaperonin GroEL |
| 174 | AP011615.1 | GCA000210375_00111 | CDS | open | 120820-121023 | _na 67_aa | hypothetical protein | |
| 175 | AP011615.1 | GCA000210375_00112 | CDS | open | 121252-122280 | _na 342_aa | isiA | Iron stress-induced chlorophyll-binding protein (CP43') |
| 176 | AP011615.1 | GCA000210375_00114 | CDS | open | 122622-123371 | _na 249_aa | alpha/beta hydrolase | |
| 177 | AP011615.1 | GCA000210375_00115 | CDS | open | 123456-123740 | _na 94_aa | hypothetical protein | |
| 178 | AP011615.1 | GCA000210375_00116 | CDS | open | 124021-126582 | _na 853_aa | exonuclease domain-containing protein | |
| 179 | AP011615.1 | GCA000210375_00117 | CDS | open | 126734-127831 | _na 365_aa | bchI | magnesium chelatase ATPase subunit I |
| 180 | AP011615.1 | GCA000210375_00118 | CDS | open | 127859-128386 | _na 175_aa | ruvC | crossover junction endodeoxyribonuclease RuvC |
| 181 | AP011615.1 | GCA000210375_00119 | CDS | open | 128403-128786 | _na 127_aa | HEAT repeat domain-containing protein | |
| 182 | AP011615.1 | GCA000210375_00120 | CDS | open | 128840-129040 | _na 66_aa | Photosystem II reaction center X protein | |
| 183 | AP011615.1 | GCA000210375_00121 | CDS | open | 129086-129649 | _na 187_aa | def | peptide deformylase |
| 184 | AP011615.1 | GCA000210375_00122 | CDS | open | 130256-130582 | _na 108_aa | hypothetical protein | |
| 185 | AP011615.1 | GCA000210375_00123 | CDS | open | 130583-131035 | _na 150_aa | hypothetical protein | |
| 186 | AP011615.1 | GCA000210375_00124 | CDS | open | 131240-131863 | _na 207_aa | estA | Lipase class 2 |
| 187 | AP011615.1 | GCA000210375_00125 | CDS | open | 131870-132667 | _na 265_aa | TIGR00297 family protein | |
| 188 | AP011615.1 | GCA000210375_00126 | CDS | open | 132731-133555 | _na 274_aa | surA | peptidylprolyl isomerase |
| 189 | AP011615.1 | GCA000210375_00127 | CDS | open | 133557-135215 | _na 552_aa | DUF1400 domain-containing protein | |
| 190 | AP011615.1 | GCA000210375_00128 | CDS | open | 135583-135933 | _na 116_aa | psb28 | photosystem II reaction center protein Psb28 |
| 191 | AP011615.1 | GCA000210375_00129 | CDS | open | 136014-137285 | _na 423_aa | hypothetical protein | |
| 192 | AP011615.1 | GCA000210375_00130 | CDS | open | 137317-137745 | _na 142_aa | yjhB | NUDIX hydrolase |
| 193 | AP011615.1 | GCA000210375_00131 | CDS | open | 137784-138242 | _na 152_aa | pro1025 | DUF3531 domain-containing protein |
| 194 | AP011615.1 | GCA000210375_00132 | CDS | open | 138375-139373 | _na 332_aa | Sll0314/Alr1548 family TPR repeat-containing protein | |
| 195 | AP011615.1 | GCA000210375_00133 | CDS | open | 139511-140179 | _na 222_aa | ecfA2 | ABC transporter related |
| 196 | AP011615.1 | GCA000210375_00134 | CDS | open | 140176-140940 | _na 254_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 197 | AP011615.1 | GCA000210375_00135 | CDS | open | 141426-141812 | _na 128_aa | aroH | chorismate mutase |
| 198 | AP011615.1 | GCA000210375_00136 | CDS | open | 141905-142726 | _na 273_aa | sppA | Protease IV%2C Signal peptide peptidase A-Serine peptidase MEROPS family S49 |
| 199 | AP011615.1 | GCA000210375_00137 | CDS | open | 143091-144134 | _na 347_aa | rhaT | EamA domain-containing protein |
| 200 | AP011615.1 | GCA000210375_00138 | CDS | open | 144173-145993 | _na 606_aa | treZ | malto-oligosyltrehalose trehalohydrolase |
| 201 | AP011615.1 | GCA000210375_00139 | CDS | open | 146045-148855 | _na 936_aa | treY | malto-oligosyltrehalose synthase |
| 202 | AP011615.1 | GCA000210375_00140 | CDS | open | 148860-149591 | _na 243_aa | radC | DNA repair protein RadC |
| 203 | AP011615.1 | GCA000210375_00141 | CDS | open | 149798-151792 | _na 664_aa | calcium-binding protein | |
| 204 | AP011615.1 | GCA000210375_00142 | CDS | open | 152298-153560 | _na 420_aa | rfaB | Glycosyl transferase group 1 |
| 205 | AP011615.1 | GCA000210375_00143 | CDS | open | 153579-155171 | _na 530_aa | Sulfotransferase | |
| 206 | AP011615.1 | GCA000210375_00144 | CDS | open | 155125-155283 | _na 52_aa | hypothetical protein | |
| 207 | AP011615.1 | GCA000210375_00145 | CDS | open | 155307-156014 | _na 235_aa | Methyltransferase type 11 | |
| 208 | AP011615.1 | GCA000210375_00146 | CDS | open | 156095-156679 | _na 194_aa | ssuE | NADPH-dependent FMN reductase |
| 209 | AP011615.1 | GCA000210375_00147 | CDS | open | 156686-157423 | _na 245_aa | yhaK | Pirin-like protein |
| 210 | AP011615.1 | GCA000210375_00148 | CDS | open | 159271-160851 | _na 526_aa | nuoN | NAD(P)H-quinone oxidoreductase subunit N |
| 211 | AP011615.1 | GCA000210375_00149 | CDS | open | 160946-161911 | _na 321_aa | cmoB | tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB |
| 212 | AP011615.1 | GCA000210375_00150 | CDS | open | 161971-162726 | _na 251_aa | cmoA | carboxy-S-adenosyl-L-methionine synthase CmoA |
| 213 | AP011615.1 | GCA000210375_00151 | CDS | open | 162887-163489 | _na 200_aa | rhtB | LysE/RhtB family amino acid efflux pump |
| 214 | AP011615.1 | GCA000210375_00152 | CDS | open | 163460-164170 | _na 236_aa | Cyclase family protein | |
| 215 | AP011615.1 | GCA000210375_00153 | CDS | open | 164190-164900 | _na 236_aa | trmN6 | tRNA1(Val) (adenine(37)-N6)-methyltransferase |
| 216 | AP011615.1 | GCA000210375_00154 | CDS | open | 164909-166069 | _na 386_aa | rlhA | Collagenase family protease |
| 217 | AP011615.1 | GCA000210375_00155 | CDS | open | 166084-167334 | _na 416_aa | rlhA | Peptidase U32 |
| 218 | AP011615.1 | GCA000210375_00156 | CDS | open | 167349-168641 | _na 430_aa | S-layer domain protein | |
| 219 | AP011615.1 | GCA000210375_00157 | CDS | open | 168693-169376 | _na 227_aa | fabG | Short-chain dehydrogenase/reductase SDR |
| 220 | AP011615.1 | GCA000210375_00158 | CDS | open | 169421-170599 | _na 392_aa | bioF | 8-amino-7-oxononanoate synthase |
| 221 | AP011615.1 | GCA000210375_00159 | CDS | open | 170612-170842 | _na 76_aa | 8-amino-7-oxononanoate synthase | |
| 222 | AP011615.1 | GCA000210375_00160 | CDS | open | 170833-171708 | _na 291_aa | Ion transport protein | |
| 223 | AP011615.1 | GCA000210375_00161 | CDS | open | 171825-173054 | _na 409_aa | degQ | HhoA/HhoB/HtrA family serine endopeptidase |
| 224 | AP011615.1 | GCA000210375_00162 | CDS | open | 173088-173357 | _na 89_aa | hypothetical protein | |
| 225 | AP011615.1 | GCA000210375_00163 | CDS | open | 173382-174362 | _na 326_aa | dnaJ | Chaperone DnaJ domain protein |
| 226 | AP011615.1 | GCA000210375_00164 | CDS | open | 174555-174995 | _na 146_aa | ibpA | Heat shock protein A |
| 227 | AP011615.1 | GCA000210375_00165 | CDS | open | 175299-175505 | _na 68_aa | Glycogen debranching enzyme | |
| 228 | AP011615.1 | GCA000210375_00166 | CDS | open | 175594-175992 | _na 132_aa | msrB | Peptide methionine sulfoxide reductase MsrB |
| 229 | AP011615.1 | GCA000210375_00167 | CDS | open | 176051-176479 | _na 142_aa | ndhV | DUF2996 domain-containing protein |
| 230 | AP011615.1 | GCA000210375_00168 | CDS | open | 176930-178534 | _na 534_aa | nhaP | Sodium/hydrogen exchanger |
| 231 | AP011615.1 | GCA000210375_00169 | CDS | open | 178591-179478 | _na 295_aa | PBS lyase HEAT domain protein repeat-containing protein | |
| 232 | AP011615.1 | GCA000210375_00170 | CDS | open | 179513-180052 | _na 179_aa | Lipoprotein | |
| 233 | AP011615.1 | GCA000210375_00171 | CDS | open | 180215-181606 | _na 463_aa | sfcA | Malate dehydrogenase (Oxaloacetate-decarboxylating) (NADP(+)) |
| 234 | AP011615.1 | GCA000210375_00172 | CDS | open | 181825-182358 | _na 177_aa | cysC | Adenylyl-sulfate kinase |
| 235 | AP011615.1 | GCA000210375_00173 | CDS | open | 182545-183066 | _na 173_aa | hpt1 | Phosphoribosyltransferase |
| 236 | AP011615.1 | GCA000210375_00174 | CDS | open | 183176-183601 | _na 141_aa | hipB | Transcriptional regulator |
| 237 | AP011615.1 | GCA000210375_00175 | CDS | open | 183784-184863 | _na 359_aa | rfaB | Glycosyl transferase%2C group 1 |
| 238 | AP011615.1 | GCA000210375_00176 | CDS | open | 184853-185209 | _na 118_aa | 2Fe2S | 2Fe-2S ferredoxin |
| 239 | AP011615.1 | GCA000210375_00177 | CDS | open | 185251-186165 | _na 304_aa | ferredoxin-thioredoxin reductase catalytic chain | |
| 240 | AP011615.1 | GCA000210375_00178 | CDS | open | 186427-187758 | _na 443_aa | opcA | glucose-6-phosphate dehydrogenase assembly protein OpcA |
| 241 | AP011615.1 | GCA000210375_00179 | CDS | open | 187816-189345 | _na 509_aa | zwf | glucose-6-phosphate dehydrogenase |
| 242 | AP011615.1 | GCA000210375_00180 | CDS | open | 189413-190486 | _na 357_aa | fbp | class 1 fructose-bisphosphatase |
| 243 | AP011615.1 | GCA000210375_00181 | CDS | open | 190673-191539 | _na 288_aa | ampD | N-acetylmuramoyl-L-alanine amidase |
| 244 | AP011615.1 | GCA000210375_00182 | CDS | open | 191772-192698 | _na 308_aa | traB | GumN family protein |
| 245 | AP011615.1 | GCA000210375_00183 | CDS | open | 192808-193821 | _na 337_aa | cydB | cytochrome d ubiquinol oxidase subunit II |
| 246 | AP011615.1 | GCA000210375_00184 | CDS | open | 193907-195346 | _na 479_aa | appC | Cytochrome bd ubiquinol oxidase%2C subunit I (CydA%2C QxtA) |
| 247 | AP011615.1 | GCA000210375_00185 | CDS | open | 195680-196300 | _na 206_aa | SHOCT domain-containing protein | |
| 248 | AP011615.1 | GCA000210375_00186 | CDS | open | 196484-197428 | _na 314_aa | hypothetical protein | |
| 249 | AP011615.1 | GCA000210375_00187 | CDS | open | 197455-198762 | _na 435_aa | ugpB | Periplasmic sugar-binding protein of ABC transporter%2C Extracellular solute-binding protein%2C family 1 |
| 250 | AP011615.1 | GCA000210375_00188 | CDS | open | 198995-200221 | _na 408_aa | fabG | bifunctional sterol desaturase/short chain dehydrogenase |
| 251 | AP011615.1 | GCA000210375_00189 | CDS | open | 200238-200669 | _na 143_aa | yjhB | ADP-ribose pyrophosphatase |
| 252 | AP011615.1 | GCA000210375_00190 | CDS | open | 200764-200958 | _na 64_aa | Phycobilisome degradation protein | |
| 253 | AP011615.1 | GCA000210375_00191 | CDS | open | 201188-203815 | _na 875_aa | priA | primosomal protein N' |
| 254 | AP011615.1 | GCA000210375_00192 | CDS | open | 203832-204989 | _na 385_aa | gCD1 | UTP--glucose-1-phosphate uridylyltransferase |
| 255 | AP011615.1 | GCA000210375_00193 | CDS | open | 205645-206262 | _na 205_aa | hypothetical protein | |
| 256 | AP011615.1 | GCA000210375_00194 | CDS | open | 206400-208088 | _na 562_aa | fHA | FHA domain-containing protein |
| 257 | AP011615.1 | GCA000210375_00195 | CDS | open | 208455-210521 | _na 688_aa | glgX | glycogen debranching protein GlgX |
| 258 | AP011615.1 | GCA000210375_00196 | CDS | open | 210556-211290 | _na 244_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 259 | AP011615.1 | GCA000210375_00197 | CDS | open | 211433-214027 | _na 864_aa | cell surface protein | |
| 260 | AP011615.1 | GCA000210375_00198 | CDS | open | 214139-215440 | _na 433_aa | dprA | DNA-processing protein DprA |
| 261 | AP011615.1 | GCA000210375_00199 | CDS | open | 215520-216914 | _na 464_aa | helicase-related protein | |
| 262 | AP011615.1 | GCA000210375_00200 | CDS | open | 217168-217605 | _na 145_aa | DEAD/DEAH box helicase | |
| 263 | AP011615.1 | GCA000210375_00201 | CDS | open | 217771-218667 | _na 298_aa | scpA | Segregation and condensation protein A |
| 264 | AP011615.1 | GCA000210375_00202 | CDS | open | 219718-221334 | _na 538_aa | gppA | Ppx/GppA Guanosine-5'-triphosphate%2C 3'-diphosphate diphosphatase |
| 265 | AP011615.1 | GCA000210375_00203 | CDS | open | 221510-222844 | _na 444_aa | GTPase | |
| 266 | AP011615.1 | GCA000210375_00204 | CDS | open | 222795-224009 | _na 404_aa | nurA | NurA domain-containing protein |
| 267 | AP011615.1 | GCA000210375_00205 | CDS | open | 224212-224676 | _na 154_aa | cyanobacterial phytochrome | |
| 268 | AP011615.1 | GCA000210375_00206 | CDS | open | 224731-227271 | _na 846_aa | ATP-binding protein | |
| 269 | AP011615.1 | GCA000210375_00207 | CDS | open | 227539-227658 | _na 39_aa | hypothetical protein | |
| 270 | AP011615.1 | GCA000210375_00208 | CDS | open | 227907-228146 | _na 79_aa | hypothetical protein | |
| 271 | AP011615.1 | GCA000210375_00209 | CDS | open | 228246-228389 | _na 47_aa | hypothetical protein | |
| 272 | AP011615.1 | GCA000210375_00210 | CDS | open | 228478-228675 | _na 65_aa | patX | heterocyst-inhibiting protein PatX |
| 273 | AP011615.1 | GCA000210375_00211 | CDS | open | 229045-229329 | _na 94_aa | DUF3288 domain-containing protein | |
| 274 | AP011615.1 | GCA000210375_00212 | CDS | open | 229336-233058 | _na 1240_aa | cobN | cobaltochelatase subunit CobN |
| 275 | AP011615.1 | GCA000210375_00213 | CDS | open | 233115-234761 | _na 548_aa | Conserved TM helix repeat-containing protein | |
| 276 | AP011615.1 | GCA000210375_00214 | CDS | open | 235081-235533 | _na 150_aa | SRPBCC family protein | |
| 277 | AP011615.1 | GCA000210375_00215 | CDS | open | 235650-236294 | _na 214_aa | DUF1400 domain-containing protein | |
| 278 | AP011615.1 | GCA000210375_00216 | CDS | open | 236401-236808 | _na 135_aa | hypothetical protein | |
| 279 | AP011615.1 | GCA000210375_00217 | CDS | open | 236857-237858 | _na 333_aa | hypothetical protein | |
| 280 | AP011615.1 | GCA000210375_00218 | CDS | open | 238819-239139 | _na 106_aa | hypothetical protein | |
| 281 | AP011615.1 | GCA000210375_00219 | CDS | open | 239132-239416 | _na 94_aa | hypothetical protein | |
| 282 | AP011615.1 | GCA000210375_00220 | CDS | open | 239435-239713 | _na 92_aa | hypothetical protein | |
| 283 | AP011615.1 | GCA000210375_00221 | CDS | open | 239776-239997 | _na 73_aa | hypothetical protein | |
| 284 | AP011615.1 | GCA000210375_00222 | CDS | open | 240010-240588 | _na 192_aa | hypothetical protein | |
| 285 | AP011615.1 | GCA000210375_00223 | CDS | open | 240585-241205 | _na 206_aa | hypothetical protein | |
| 286 | AP011615.1 | GCA000210375_00224 | CDS | open | 241286-241999 | _na 237_aa | hypothetical protein | |
| 287 | AP011615.1 | GCA000210375_00225 | CDS | open | 242002-242328 | _na 108_aa | hypothetical protein | |
| 288 | AP011615.1 | GCA000210375_00226 | CDS | open | 242321-242725 | _na 134_aa | DUF1064 domain-containing protein | |
| 289 | AP011615.1 | GCA000210375_00227 | CDS | open | 242715-243068 | _na 117_aa | faxG | Protein faxG fax element |
| 290 | AP011615.1 | GCA000210375_00228 | CDS | open | 243181-243549 | _na 122_aa | hypothetical protein | |
| 291 | AP011615.1 | GCA000210375_00229 | CDS | open | 243848-244498 | _na 216_aa | hypothetical protein | |
| 292 | AP011615.1 | GCA000210375_00230 | CDS | open | 244579-244824 | _na 81_aa | hypothetical protein | |
| 293 | AP011615.1 | GCA000210375_00231 | CDS | open | 244943-246640 | _na 565_aa | hypothetical protein | |
| 294 | AP011615.1 | GCA000210375_00232 | CDS | open | 246640-247458 | _na 272_aa | hypothetical protein | |
| 295 | AP011615.1 | GCA000210375_00233 | CDS | open | 247451-248461 | _na 336_aa | hypothetical protein | |
| 296 | AP011615.1 | GCA000210375_00234 | CDS | open | 248528-248788 | _na 86_aa | hypothetical protein | |
| 297 | AP011615.1 | GCA000210375_00235 | CDS | open | 248752-249321 | _na 189_aa | hypothetical protein | |
| 298 | AP011615.1 | GCA000210375_00236 | CDS | open | 249348-249695 | _na 115_aa | hypothetical protein | |
| 299 | AP011615.1 | GCA000210375_00237 | CDS | open | 249762-250988 | _na 408_aa | hypothetical protein | |
| 300 | AP011615.1 | GCA000210375_00238 | CDS | open | 251145-251861 | _na 238_aa | tail fiber domain-containing protein | |
| 301 | AP011615.1 | GCA000210375_00239 | CDS | open | 251873-252094 | _na 73_aa | hypothetical protein | |
| 302 | AP011615.1 | GCA000210375_00240 | CDS | open | 252226-252480 | _na 84_aa | hypothetical protein | |
| 303 | AP011615.1 | GCA000210375_00241 | CDS | open | 253663-254487 | _na 274_aa | sirB1 | Protein SirB1 N-terminal domain-containing protein |
| 304 | AP011615.1 | GCA000210375_00242 | CDS | open | 254543-256258 | _na 571_aa | mutL | DNA mismatch repair endonuclease MutL |
| 305 | AP011615.1 | GCA000210375_00243 | CDS | open | 256297-256785 | _na 162_aa | hypothetical protein | |
| 306 | AP011615.1 | GCA000210375_00245 | CDS | open | 257749-258774 | _na 341_aa | ABC transporter substrate-binding protein | |
| 307 | AP011615.1 | GCA000210375_00246 | CDS | open | 258888-260147 | _na 419_aa | ubiH | FAD-dependent hydroxylase |
| 308 | AP011615.1 | GCA000210375_00247 | CDS | open | 260406-260882 | _na 158_aa | lspA | signal peptidase II |
| 309 | AP011615.1 | GCA000210375_00248 | CDS | open | 260898-261482 | _na 194_aa | bioY | Biotin transporter |
| 310 | AP011615.1 | GCA000210375_00249 | CDS | open | 261486-262637 | _na 383_aa | bioB | biotin synthase BioB |
| 311 | AP011615.1 | GCA000210375_00250 | CDS | open | 263150-264226 | _na 358_aa | pstS | phosphate ABC transporter substrate-binding protein PstS |
| 312 | AP011615.1 | GCA000210375_00251 | CDS | open | 264521-265486 | _na 321_aa | pstC | phosphate ABC transporter permease subunit PstC |
| 313 | AP011615.1 | GCA000210375_00252 | CDS | open | 265567-266472 | _na 301_aa | pstA | phosphate ABC transporter permease PstA |
| 314 | AP011615.1 | GCA000210375_00253 | CDS | open | 266540-267349 | _na 269_aa | pstB | phosphate ABC transporter ATP-binding protein PstB |
| 315 | AP011615.1 | GCA000210375_00254 | CDS | open | 267568-268395 | _na 275_aa | pstB | phosphate ABC transporter ATP-binding protein PstB |
| 316 | AP011615.1 | GCA000210375_00255 | CDS | open | 268492-268659 | _na 55_aa | nblA | Phycobilisome degradation protein NblA |
| 317 | AP011615.1 | GCA000210375_00256 | CDS | open | 268893-269486 | _na 197_aa | ycf58 | Chromophore lyase CpcS/CpeS |
| 318 | AP011615.1 | GCA000210375_00257 | CDS | open | 269601-269912 | _na 103_aa | uma2 | Putative restriction endonuclease domain-containing protein |
| 319 | AP011615.1 | GCA000210375_00258 | CDS | open | 269928-270203 | _na 91_aa | uma2 | Putative restriction endonuclease domain-containing protein |
| 320 | AP011615.1 | GCA000210375_00259 | CDS | open | 272479-272661 | _na 60_aa | DUF2281 domain-containing protein | |
| 321 | AP011615.1 | GCA000210375_00260 | CDS | open | 273010-273414 | _na 134_aa | vapC | PIN domain-containing protein |
| 322 | AP011615.1 | GCA000210375_00261 | CDS | open | 273414-273656 | _na 80_aa | Antitoxin | |
| 323 | AP011615.1 | GCA000210375_00262 | CDS | open | 273669-273875 | _na 68_aa | hypothetical protein | |
| 324 | AP011615.1 | GCA000210375_00263 | CDS | open | 274022-274393 | _na 123_aa | hypothetical protein | |
| 325 | AP011615.1 | GCA000210375_00264 | CDS | open | 274335-274646 | _na 103_aa | vapC | type II toxin-antitoxin system VapC family toxin |
| 326 | AP011615.1 | GCA000210375_00265 | CDS | open | 274612-274845 | _na 77_aa | PIN domain-containing protein | |
| 327 | AP011615.1 | GCA000210375_00266 | CDS | open | 275064-275300 | _na 78_aa | hypothetical protein | |
| 328 | AP011615.1 | GCA000210375_00267 | CDS | open | 275304-275870 | _na 188_aa | DUF3368 domain-containing protein | |
| 329 | AP011615.1 | GCA000210375_00268 | CDS | open | 275877-276086 | _na 69_aa | parD | type II toxin-antitoxin system ParD family antitoxin |
| 330 | AP011615.1 | GCA000210375_00269 | CDS | open | 276267-279125 | _na 952_aa | tetratricopeptide repeat protein | |
| 331 | AP011615.1 | GCA000210375_00270 | CDS | open | 279364-281151 | _na 595_aa | ATP-binding protein | |
| 332 | AP011615.1 | GCA000210375_00271 | CDS | open | 282233-283444 | _na 403_aa | tetratricopeptide repeat protein | |
| 333 | AP011615.1 | GCA000210375_00272 | CDS | open | 283981-284592 | _na 203_aa | tsaC | L-threonylcarbamoyladenylate synthase |
| 334 | AP011615.1 | GCA000210375_00273 | CDS | open | 284677-285654 | _na 325_aa | kdpD | sensor histidine kinase KdpD |
| 335 | AP011615.1 | GCA000210375_00274 | CDS | open | 285688-286572 | _na 294_aa | ubiA | 4-hydroxybenzoate solanesyltransferase |
| 336 | AP011615.1 | GCA000210375_00275 | CDS | open | 286981-288093 | _na 370_aa | tPR | Tetratricopeptide TPR_2 repeat protein |
| 337 | AP011615.1 | GCA000210375_00276 | CDS | open | 288257-288883 | _na 208_aa | erfK | Beta-lactam-insensitive peptidoglycan transpeptidase (ErfK/YbiS/YcfS/YnhG family) |
| 338 | AP011615.1 | GCA000210375_00277 | CDS | open | 288998-289117 | _na 39_aa | psbY | photosystem II protein Y |
| 339 | AP011615.1 | GCA000210375_00278 | CDS | open | 289575-290015 | _na 146_aa | rbfA | 30S ribosome-binding factor RbfA |
| 340 | AP011615.1 | GCA000210375_00279 | CDS | open | 290041-291624 | _na 527_aa | bglX | beta-N-acetylhexosaminidase |
| 341 | AP011615.1 | GCA000210375_00280 | CDS | open | 292030-292254 | _na 74_aa | DUF4327 domain-containing protein | |
| 342 | AP011615.1 | GCA000210375_00281 | CDS | open | 292562-293950 | _na 462_aa | thiC | phosphomethylpyrimidine synthase |
| 343 | AP011615.1 | GCA000210375_00282 | CDS | open | 294189-294536 | _na 115_aa | ibpA | SHSP domain-containing protein |
| 344 | AP011615.1 | GCA000210375_00283 | CDS | open | 294787-297039 | _na 750_aa | hypothetical protein | |
| 345 | AP011615.1 | GCA000210375_00284 | CDS | open | 297154-297453 | _na 99_aa | SUMF1/EgtB/PvdO family nonheme iron enzyme | |
| 346 | AP011615.1 | GCA000210375_00285 | CDS | open | 297740-298096 | _na 118_aa | hypothetical protein | |
| 347 | AP011615.1 | GCA000210375_00286 | CDS | open | 298422-299813 | _na 463_aa | SLH domain-containing protein | |
| 348 | AP011615.1 | GCA000210375_00287 | CDS | open | 299779-301062 | _na 427_aa | ctpB | carboxyl-terminal processing protease CtpB |
| 349 | AP011615.1 | GCA000210375_00288 | CDS | open | 301386-302204 | _na 272_aa | Tetratricopeptide repeat protein | |
| 350 | AP011615.1 | GCA000210375_00289 | CDS | open | 302220-302921 | _na 233_aa | ompR | DNA-binding response regulator in two-component regulatory system with BaeS |
| 351 | AP011615.1 | GCA000210375_00290 | CDS | open | 302971-303783 | _na 270_aa | tauE | putative membrane transporter protein |
| 352 | AP011615.1 | GCA000210375_00291 | CDS | open | 303794-304765 | _na 323_aa | fmdA | Acetamidase/Formamidase |
| 353 | AP011615.1 | GCA000210375_00292 | CDS | open | 304772-306232 | _na 486_aa | mscK | Mechanosensitive ion channel |
| 354 | AP011615.1 | GCA000210375_00293 | CDS | open | 306851-307366 | _na 171_aa | rAYT | REP-associated tyrosine transposase |
| 355 | AP011615.1 | GCA000210375_00294 | CDS | open | 308067-310733 | _na 888_aa | Peptidase M10A and M12B matrixin and adamalysin | |
| 356 | AP011615.1 | GCA000210375_00295 | CDS | open | 310733-311194 | _na 153_aa | djlA | Co-chaperone DjlA N-terminal domain-containing protein |
| 357 | AP011615.1 | GCA000210375_00296 | CDS | open | 311301-311651 | _na 116_aa | ccmK | Carboxysome shell protein CcmK |
| 358 | AP011615.1 | GCA000210375_00297 | CDS | open | 311772-312080 | _na 102_aa | ccmK | Carboxysome shell protein CcmK |
| 359 | AP011615.1 | GCA000210375_00298 | CDS | open | 312275-313666 | _na 463_aa | asnS | asparagine--tRNA ligase |
| 360 | AP011615.1 | GCA000210375_00299 | CDS | open | 313817-314947 | _na 376_aa | fixC | Geranylgeranyl reductase |
| 361 | AP011615.1 | GCA000210375_00300 | CDS | open | 315220-315639 | _na 139_aa | hypothetical protein | |
| 362 | AP011615.1 | GCA000210375_00301 | CDS | open | 315949-316353 | _na 134_aa | Glyoxalase/bleomycin resistance protein/dioxygenase | |
| 363 | AP011615.1 | GCA000210375_00302 | CDS | open | 316377-316886 | _na 169_aa | TIGR02652 family protein | |
| 364 | AP011615.1 | GCA000210375_00303 | CDS | open | 316966-317520 | _na 184_aa | paaY | Transferase hexapeptide repeat containing protein |
| 365 | AP011615.1 | GCA000210375_00304 | CDS | open | 317605-318081 | _na 158_aa | hypothetical protein | |
| 366 | AP011615.1 | GCA000210375_00305 | CDS | open | 319226-319501 | _na 91_aa | sipA | regulatory protein SipA |
| 367 | AP011615.1 | GCA000210375_00306 | CDS | open | 319531-320286 | _na 251_aa | DUF1400 domain-containing protein | |
| 368 | AP011615.1 | GCA000210375_00307 | CDS | open | 320749-321645 | _na 298_aa | gspF | Type II secretion system protein |
| 369 | AP011615.1 | GCA000210375_00308 | CDS | open | 321795-323555 | _na 586_aa | mamA | magnetosome protein MamA |
| 370 | AP011615.1 | GCA000210375_00309 | CDS | open | 324073-324420 | _na 115_aa | Mo-dependent nitrogenase family protein | |
| 371 | AP011615.1 | GCA000210375_00310 | CDS | open | 324699-325145 | _na 148_aa | ftsL | Cell division protein FtsL |
| 372 | AP011615.1 | GCA000210375_00311 | CDS | open | 325421-325516 | _na 31_aa | psaM | photosystem I reaction center subunit XII |
| 373 | AP011615.1 | GCA000210375_00312 | CDS | open | 325682-326131 | _na 149_aa | ndk | nucleoside-diphosphate kinase |
| 374 | AP011615.1 | GCA000210375_00313 | CDS | open | 326303-328195 | _na 630_aa | modB | molybdate ABC transporter permease subunit |
| 375 | AP011615.1 | GCA000210375_00314 | CDS | open | 328199-329590 | _na 463_aa | DUF1800 domain-containing protein | |
| 376 | AP011615.1 | GCA000210375_00315 | CDS | open | 329612-330910 | _na 432_aa | dotG | Pentapeptide repeat protein |
| 377 | AP011615.1 | GCA000210375_00316 | CDS | open | 331052-331267 | _na 71_aa | Transposase | |
| 378 | AP011615.1 | GCA000210375_00317 | CDS | open | 331503-332990 | _na 495_aa | acyC | Adenylate/guanylate cyclase |
| 379 | AP011615.1 | GCA000210375_00318 | CDS | open | 333035-333931 | _na 298_aa | Two-component response regulator%2C modulated diguanylate cyclase | |
| 380 | AP011615.1 | GCA000210375_00319 | CDS | open | 334045-334896 | _na 283_aa | response regulator | |
| 381 | AP011615.1 | GCA000210375_00320 | CDS | open | 335041-338163 | _na 1040_aa | PAS domain S-box protein | |
| 382 | AP011615.1 | GCA000210375_00321 | CDS | open | 338200-340455 | _na 751_aa | GAF domain-containing sensor histidine kinase | |
| 383 | AP011615.1 | GCA000210375_00322 | CDS | open | 340661-341062 | _na 133_aa | DUF4168 domain-containing protein | |
| 384 | AP011615.1 | GCA000210375_00323 | CDS | open | 341519-342994 | _na 491_aa | glgA | glycogen synthase GlgA |
| 385 | AP011615.1 | GCA000210375_00324 | CDS | open | 343112-343915 | _na 267_aa | sulfotransferase domain-containing protein | |
| 386 | AP011615.1 | GCA000210375_00325 | CDS | open | 344076-345221 | _na 381_aa | crp | histidine kinase |
| 387 | AP011615.1 | GCA000210375_00326 | CDS | open | 345235-345909 | _na 224_aa | wcaG | NAD-dependent epimerase/dehydratase |
| 388 | AP011615.1 | GCA000210375_00327 | CDS | open | 346315-347238 | _na 307_aa | hflC | Protease%2C membrane anchored%2C stomatin/prohibitin-like proteins |
| 389 | AP011615.1 | GCA000210375_00328 | CDS | open | 347277-347705 | _na 142_aa | ybbJ | Membrane protein implicated in regulation of membrane protease activity |
| 390 | AP011615.1 | GCA000210375_00329 | CDS | open | 347852-349855 | _na 667_aa | pTC1 | Protein serine/threonine phosphatase |
| 391 | AP011615.1 | GCA000210375_00330 | CDS | open | 350344-351513 | _na 389_aa | abrB | Membrane protein AbrB duplication |
| 392 | AP011615.1 | GCA000210375_00331 | CDS | open | 351638-352099 | _na 153_aa | bcp | thioredoxin-dependent peroxiredoxin |
| 393 | AP011615.1 | GCA000210375_00332 | CDS | open | 352290-353879 | _na 529_aa | ygiQ | Enzyme |
| 394 | AP011615.1 | GCA000210375_00333 | CDS | open | 353967-354653 | _na 228_aa | deoC | deoxyribose-phosphate aldolase |
| 395 | AP011615.1 | GCA000210375_00334 | CDS | open | 354659-355555 | _na 298_aa | recO | DNA repair protein RecO |
| 396 | AP011615.1 | GCA000210375_00335 | CDS | open | 355641-356720 | _na 359_aa | Type-2 restriction endonuclease (Prototype AcyI/HgiDI) | |
| 397 | AP011615.1 | GCA000210375_00336 | CDS | open | 356732-357676 | _na 314_aa | dcm | Cytosine-specific methyltransferase |
| 398 | AP011615.1 | GCA000210375_00337 | CDS | open | 358306-358785 | _na 159_aa | rsbW | Anti-Sigma regulatory factor (Ser/Thr protein kinase) |
| 399 | AP011615.1 | GCA000210375_00338 | CDS | open | 358816-359094 | _na 92_aa | DUF6439 domain-containing protein | |
| 400 | AP011615.1 | GCA000210375_00339 | CDS | open | 359136-359519 | _na 127_aa | DUF2203 domain-containing protein | |
| 401 | AP011615.1 | GCA000210375_00340 | CDS | open | 359534-360643 | _na 369_aa | mtnA | S-methyl-5-thioribose-1-phosphate isomerase |
| 402 | AP011615.1 | GCA000210375_00341 | CDS | open | 360733-363672 | _na 979_aa | gcvP | aminomethyl-transferring glycine dehydrogenase |
| 403 | AP011615.1 | GCA000210375_00342 | CDS | open | 364179-365351 | _na 390_aa | wecG | N-acetylglucosaminyldiphosphoundecaprenol N-acetyl-beta-D-mannosaminyltransferase |
| 404 | AP011615.1 | GCA000210375_00343 | CDS | open | 365678-366904 | _na 408_aa | Beta-lactamase class A catalytic domain-containing protein | |
| 405 | AP011615.1 | GCA000210375_00344 | CDS | open | 366945-367349 | _na 134_aa | rplL | 50S ribosomal protein L7/L12 |
| 406 | AP011615.1 | GCA000210375_00345 | CDS | open | 367397-367966 | _na 189_aa | rplJ | 50S ribosomal protein L10 |
| 407 | AP011615.1 | GCA000210375_00346 | CDS | open | 368392-369108 | _na 238_aa | rplA | 50S ribosomal protein L1 |
| 408 | AP011615.1 | GCA000210375_00347 | CDS | open | 369205-369630 | _na 141_aa | rplK | 50S ribosomal protein L11 |
| 409 | AP011615.1 | GCA000210375_00348 | CDS | open | 369634-370305 | _na 223_aa | nusG | transcription termination/antitermination protein NusG |
| 410 | AP011615.1 | GCA000210375_00349 | CDS | open | 370302-370526 | _na 74_aa | secE | preprotein translocase subunit SecE |
| 411 | AP011615.1 | GCA000210375_00351 | CDS | open | 370926-371312 | _na 128_aa | rplS | 50S ribosomal protein L19 |
| 412 | AP011615.1 | GCA000210375_00352 | CDS | open | 371504-372442 | _na 312_aa | glyQ | glycine--tRNA ligase subunit alpha |
| 413 | AP011615.1 | GCA000210375_00353 | CDS | open | 372537-373007 | _na 156_aa | hypothetical protein | |
| 414 | AP011615.1 | GCA000210375_00354 | CDS | open | 373106-373249 | _na 47_aa | hypothetical protein | |
| 415 | AP011615.1 | GCA000210375_00355 | CDS | open | 373656-373949 | _na 97_aa | hypothetical protein | |
| 416 | AP011615.1 | GCA000210375_00356 | CDS | open | 373942-375561 | _na 539_aa | DUF2079 domain-containing protein | |
| 417 | AP011615.1 | GCA000210375_00357 | CDS | open | 375781-376968 | _na 395_aa | kdpD | histidine kinase |
| 418 | AP011615.1 | GCA000210375_00358 | CDS | open | 377127-378317 | _na 396_aa | tnpB | RNA-guided endonuclease TnpB family protein |
| 419 | AP011615.1 | GCA000210375_00359 | CDS | open | 378548-378964 | _na 138_aa | mutT | 8-oxo-dGTP diphosphatase MutT |
| 420 | AP011615.1 | GCA000210375_00360 | CDS | open | 379040-380035 | _na 331_aa | rpoD | Group 2 RNA polymerase sigma factor SigD (RpoD family) |
| 421 | AP011615.1 | GCA000210375_00361 | CDS | open | 380580-381371 | _na 263_aa | Peptidase%2C T1 family | |
| 422 | AP011615.1 | GCA000210375_00362 | CDS | open | 381471-382430 | _na 319_aa | dppB | Oligopeptide transport system permease protein (ABC superfamily%2C OppBC subfamily) |
| 423 | AP011615.1 | GCA000210375_00363 | CDS | open | 382437-382667 | _na 76_aa | hypothetical protein | |
| 424 | AP011615.1 | GCA000210375_00364 | CDS | open | 382740-383636 | _na 298_aa | dppC | Oligopeptide transport system permease protein oppC (ABC superfamily%2C membrane) |
| 425 | AP011615.1 | GCA000210375_00365 | CDS | open | 383737-384387 | _na 216_aa | alkB | Oxidoreductase%2C 2OG-Fe(II) oxygenase family |
| 426 | AP011615.1 | GCA000210375_00366 | CDS | open | 384586-386772 | _na 728_aa | dynamin family protein | |
| 427 | AP011615.1 | GCA000210375_00367 | CDS | open | 386812-387789 | _na 325_aa | Double-GTPase 2 domain-containing protein | |
| 428 | AP011615.1 | GCA000210375_00368 | CDS | open | 387801-388937 | _na 378_aa | hypothetical protein | |
| 429 | AP011615.1 | GCA000210375_00369 | CDS | open | 389023-389685 | _na 220_aa | uma2 | Putative restriction endonuclease domain-containing protein |
| 430 | AP011615.1 | GCA000210375_00370 | CDS | open | 389688-389921 | _na 77_aa | DUF433 domain-containing protein | |
| 431 | AP011615.1 | GCA000210375_00371 | CDS | open | 390113-390502 | _na 129_aa | PIN domain-containing protein | |
| 432 | AP011615.1 | GCA000210375_00372 | CDS | open | 390499-390729 | _na 76_aa | type II toxin-antitoxin system Phd/YefM family antitoxin | |
| 433 | AP011615.1 | GCA000210375_00373 | CDS | open | 391444-392469 | _na 341_aa | CHAT domain-containing protein | |
| 434 | AP011615.1 | GCA000210375_00374 | CDS | open | 392554-393774 | _na 406_aa | tnpB | RNA-guided endonuclease TnpB family protein |
| 435 | AP011615.1 | GCA000210375_00375 | CDS | open | 393856-394683 | _na 275_aa | tetratricopeptide repeat protein | |
| 436 | AP011615.1 | GCA000210375_00376 | CDS | open | 394928-395053 | _na 41_aa | parD | Type II toxin-antitoxin system ParD family antitoxin |
| 437 | AP011615.1 | GCA000210375_00377 | CDS | open | 395081-395179 | _na 32_aa | hypothetical protein | |
| 438 | AP011615.1 | GCA000210375_00378 | CDS | open | 395250-395489 | _na 79_aa | Toxin-antitoxin system%2C antitoxin component | |
| 439 | AP011615.1 | GCA000210375_00379 | CDS | open | 395495-395977 | _na 160_aa | DUF3368 domain-containing protein | |
| 440 | AP011615.1 | GCA000210375_00380 | CDS | open | 396246-396371 | _na 41_aa | parD | Type II toxin-antitoxin system ParD family antitoxin |
| 441 | AP011615.1 | GCA000210375_00381 | CDS | open | 396399-396497 | _na 32_aa | hypothetical protein | |
| 442 | AP011615.1 | GCA000210375_00382 | CDS | open | 396669-396854 | _na 61_aa | hypothetical protein | |
| 443 | AP011615.1 | GCA000210375_00383 | CDS | open | 396847-397236 | _na 129_aa | type II toxin-antitoxin system death-on-curing family toxin | |
| 444 | AP011615.1 | GCA000210375_00384 | CDS | open | 397710-397928 | _na 72_aa | DUF104 domain-containing protein | |
| 445 | AP011615.1 | GCA000210375_00385 | CDS | open | 397991-398233 | _na 80_aa | DUF2281 domain-containing protein | |
| 446 | AP011615.1 | GCA000210375_00386 | CDS | open | 398230-398445 | _na 71_aa | vapC | Type II toxin-antitoxin system VapC family toxin |
| 447 | AP011615.1 | GCA000210375_00387 | CDS | open | 398512-398643 | _na 43_aa | hypothetical protein | |
| 448 | AP011615.1 | GCA000210375_00388 | CDS | open | 398753-399295 | _na 180_aa | Lipoprotein | |
| 449 | AP011615.1 | GCA000210375_00389 | CDS | open | 399331-399735 | _na 134_aa | hypothetical protein | |
| 450 | AP011615.1 | GCA000210375_00390 | CDS | open | 400418-401353 | _na 311_aa | hypothetical protein | |
| 451 | AP011615.1 | GCA000210375_00391 | CDS | open | 401463-402173 | _na 236_aa | phoE | Phosphoglycerate mutase |
| 452 | AP011615.1 | GCA000210375_00392 | CDS | open | 402103-402258 | _na 51_aa | hypothetical protein | |
| 453 | AP011615.1 | GCA000210375_00393 | CDS | open | 402297-403577 | _na 426_aa | ahcY | adenosylhomocysteinase |
| 454 | AP011615.1 | GCA000210375_00394 | CDS | open | 403695-404318 | _na 207_aa | exoD | Exopolysaccharide synthesis |
| 455 | AP011615.1 | GCA000210375_00395 | CDS | open | 404517-404984 | _na 155_aa | hypothetical protein | |
| 456 | AP011615.1 | GCA000210375_00396 | CDS | open | 405122-406126 | _na 334_aa | afuA | Extracellular solute-binding protein family 1 |
| 457 | AP011615.1 | GCA000210375_00397 | CDS | open | 406396-407874 | _na 492_aa | pyrE | bifunctional orotidine-5'-phosphate decarboxylase/orotate phosphoribosyltransferase |
| 458 | AP011615.1 | GCA000210375_00398 | CDS | open | 407933-408124 | _na 63_aa | hypothetical protein | |
| 459 | AP011615.1 | GCA000210375_00399 | CDS | open | 408115-408567 | _na 150_aa | DUF3611 domain-containing protein | |
| 460 | AP011615.1 | GCA000210375_00400 | CDS | open | 408616-409365 | _na 249_aa | pflA | pyruvate formate-lyase-activating protein |
| 461 | AP011615.1 | GCA000210375_00401 | CDS | open | 409488-411779 | _na 763_aa | pflB | formate C-acetyltransferase |
| 462 | AP011615.1 | GCA000210375_00402 | CDS | open | 412547-412894 | _na 115_aa | hinT | Purine nucleoside phosphoramidase |
| 463 | AP011615.1 | GCA000210375_00403 | CDS | open | 412904-414529 | _na 541_aa | methyl-accepting chemotaxis protein | |
| 464 | AP011615.1 | GCA000210375_00404 | CDS | open | 414738-415424 | _na 228_aa | udk | Uridine kinase |
| 465 | AP011615.1 | GCA000210375_00405 | CDS | open | 415525-416016 | _na 163_aa | hypothetical protein | |
| 466 | AP011615.1 | GCA000210375_00406 | CDS | open | 416037-417143 | _na 368_aa | Transposase | |
| 467 | AP011615.1 | GCA000210375_00407 | CDS | open | 417194-417460 | _na 88_aa | hypothetical protein | |
| 468 | AP011615.1 | GCA000210375_00408 | CDS | open | 417903-418466 | _na 187_aa | padR | Transcriptional regulator%2C PadR-like family |
| 469 | AP011615.1 | GCA000210375_00409 | CDS | open | 418552-420132 | _na 526_aa | acrA | Efflux transporter%2C RND family%2C MFP subunit |
| 470 | AP011615.1 | GCA000210375_00410 | CDS | open | 420175-423471 | _na 1098_aa | acrB | Transporter%2C hydrophobe/amphiphile efflux pump (RND/HAE1) family |
| 471 | AP011615.1 | GCA000210375_00411 | CDS | open | 423472-424146 | _na 224_aa | gdt1 | GDT1 family protein |
| 472 | AP011615.1 | GCA000210375_00412 | CDS | open | 424407-426029 | _na 540_aa | malQ | 4-alpha-glucanotransferase |
| 473 | AP011615.1 | GCA000210375_00413 | CDS | open | 426049-426963 | _na 304_aa | rodZ | Transcriptional regulator%2C XRE family |
| 474 | AP011615.1 | GCA000210375_00414 | CDS | open | 426976-427749 | _na 257_aa | rsuA | Pseudouridine synthase |
| 475 | AP011615.1 | GCA000210375_00415 | CDS | open | 427985-428677 | _na 230_aa | DUF2993 domain-containing protein | |
| 476 | AP011615.1 | GCA000210375_00416 | CDS | open | 428674-429564 | _na 296_aa | cdsA | phosphatidate cytidylyltransferase |
| 477 | AP011615.1 | GCA000210375_00417 | CDS | open | 429680-430282 | _na 200_aa | cbiT | precorrin-6Y C5%2C15-methyltransferase subunit CbiT |
| 478 | AP011615.1 | GCA000210375_00418 | CDS | open | 430343-431833 | _na 496_aa | ldcC | Orn/Lys/Arg decarboxylase family protein |
| 479 | AP011615.1 | GCA000210375_00419 | CDS | open | 431948-433039 | _na 363_aa | ychF | redox-regulated ATPase YchF |
| 480 | AP011615.1 | GCA000210375_00420 | CDS | open | 433177-433542 | _na 121_aa | phage holin family protein | |
| 481 | AP011615.1 | GCA000210375_00421 | CDS | open | 433606-433956 | _na 116_aa | Transcriptional regulator | |
| 482 | AP011615.1 | GCA000210375_00422 | CDS | open | 434055-435581 | _na 508_aa | yifB | AAA+ ATPase domain-containing protein |
| 483 | AP011615.1 | GCA000210375_00423 | CDS | open | 435616-437481 | _na 621_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 484 | AP011615.1 | GCA000210375_00424 | CDS | open | 437491-438996 | _na 501_aa | pitA | Phosphate transporter |
| 485 | AP011615.1 | GCA000210375_00425 | CDS | open | 439077-439739 | _na 220_aa | ykaA | Phosphate transport regulator |
| 486 | AP011615.1 | GCA000210375_00426 | CDS | open | 440910-441071 | _na 53_aa | hypothetical protein | |
| 487 | AP011615.1 | GCA000210375_00427 | CDS | open | 441068-441283 | _na 71_aa | hypothetical protein | |
| 488 | AP011615.1 | GCA000210375_00428 | CDS | open | 441314-442660 | _na 448_aa | NB-ARC domain | |
| 489 | AP011615.1 | GCA000210375_00429 | CDS | open | 443408-444001 | _na 197_aa | helix-turn-helix domain-containing protein | |
| 490 | AP011615.1 | GCA000210375_00430 | CDS | open | 444060-446774 | _na 904_aa | sunT | Bacteriocin-processing peptidase Cysteine peptidase MEROPS family C39 Cyclic nucleotide-regulated ABC bacteriocin/lantibiotic exporter |
| 491 | AP011615.1 | GCA000210375_00431 | CDS | open | 446808-448544 | _na 578_aa | emrA | Membrane fusion protein biotin-lipoyl like domain-containing protein |
| 492 | AP011615.1 | GCA000210375_00432 | CDS | open | 448596-449336 | _na 246_aa | peptidylprolyl isomerase | |
| 493 | AP011615.1 | GCA000210375_00433 | CDS | open | 449442-449753 | _na 103_aa | hypothetical protein | |
| 494 | AP011615.1 | GCA000210375_00434 | CDS | open | 450143-450415 | _na 90_aa | hicB | type II toxin-antitoxin system HicB family antitoxin |
| 495 | AP011615.1 | GCA000210375_00435 | CDS | open | 450393-450623 | _na 76_aa | hicA | type II toxin-antitoxin system HicA family toxin |
| 496 | AP011615.1 | GCA000210375_00436 | CDS | open | 450850-451968 | _na 372_aa | DUF3396 domain-containing protein | |
| 497 | AP011615.1 | GCA000210375_00437 | CDS | open | 451993-453162 | _na 389_aa | ycbJ | Aminoglycoside phosphotransferase domain-containing protein |
| 498 | AP011615.1 | GCA000210375_00438 | CDS | open | 453870-454235 | _na 121_aa | DUF5615 domain-containing protein | |
| 499 | AP011615.1 | GCA000210375_00439 | CDS | open | 454238-454468 | _na 76_aa | Toxin-antitoxin system antidote component | |
| 500 | AP011615.1 | GCA000210375_00440 | CDS | open | 455495-457261 | _na 588_aa | ltrA | group II intron reverse transcriptase/maturase |

